Incidental Mutation 'R5745:Hectd4'
ID 445743
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission 043198-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 121220219-121368577 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121353502 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 3668 (V3668M)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: V3668M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: V3668M

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104159
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 (GRCm38) R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 (GRCm38) probably null Het
Adcy8 A T 15: 64,920,471 (GRCm38) I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 (GRCm38) T879A probably damaging Het
Copb2 T C 9: 98,574,111 (GRCm38) S233P probably damaging Het
Cpa5 T A 6: 30,630,437 (GRCm38) M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 (GRCm38) N361K probably benign Het
Dmxl1 A G 18: 49,846,586 (GRCm38) E96G probably benign Het
Dock8 T A 19: 25,130,397 (GRCm38) N830K probably benign Het
Ephb1 C T 9: 102,195,434 (GRCm38) D49N probably benign Het
Fam19a1 G A 6: 96,649,185 (GRCm38) R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 (GRCm38) I514V probably benign Het
Fpr1 A G 17: 17,877,082 (GRCm38) I215T probably benign Het
Ighv3-4 T A 12: 114,253,768 (GRCm38) I68L probably benign Het
Intu A G 3: 40,692,972 (GRCm38) probably null Het
Kel C T 6: 41,699,027 (GRCm38) G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 (GRCm38) S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 (GRCm38) S1211T probably benign Het
Nrp1 A T 8: 128,468,448 (GRCm38) I462F probably benign Het
Olfr787 T A 10: 129,463,438 (GRCm38) I254N probably damaging Het
Olfr958 T C 9: 39,550,691 (GRCm38) Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 (GRCm38) S635R probably benign Het
Pms1 A T 1: 53,207,702 (GRCm38) Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 (GRCm38) probably benign Het
Sema3b C A 9: 107,601,429 (GRCm38) A356S probably damaging Het
Shoc2 C A 19: 54,029,892 (GRCm38) T485K probably benign Het
Slc7a7 G A 14: 54,377,835 (GRCm38) S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 (GRCm38) T918S probably benign Het
Tle3 C A 9: 61,414,851 (GRCm38) F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 (GRCm38) I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 (GRCm38) H57Q possibly damaging Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121,363,870 (GRCm38) missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121,349,106 (GRCm38) missense probably benign 0.18
IGL01085:Hectd4 APN 5 121,331,701 (GRCm38) missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121,306,950 (GRCm38) missense probably benign 0.01
IGL01402:Hectd4 APN 5 121,339,417 (GRCm38) splice site probably benign
IGL01474:Hectd4 APN 5 121,336,649 (GRCm38) missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121,318,651 (GRCm38) missense probably benign 0.28
IGL01548:Hectd4 APN 5 121,364,660 (GRCm38) missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121,322,700 (GRCm38) missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121,344,824 (GRCm38) missense probably benign 0.28
IGL01819:Hectd4 APN 5 121,328,418 (GRCm38) missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121,366,606 (GRCm38) utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121,292,087 (GRCm38) missense probably benign 0.33
IGL02490:Hectd4 APN 5 121,318,613 (GRCm38) missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121,344,785 (GRCm38) missense probably benign 0.28
IGL02626:Hectd4 APN 5 121,353,881 (GRCm38) missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121,349,402 (GRCm38) missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121,342,719 (GRCm38) missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121,307,004 (GRCm38) missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121,365,053 (GRCm38) missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121,365,053 (GRCm38) missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121,365,053 (GRCm38) missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121,365,053 (GRCm38) missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121,348,794 (GRCm38) missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121,365,053 (GRCm38) missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121,259,879 (GRCm38) missense probably benign
IGL03181:Hectd4 APN 5 121,353,958 (GRCm38) missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121,259,939 (GRCm38) splice site probably benign
IGL03375:Hectd4 APN 5 121,328,382 (GRCm38) missense possibly damaging 0.72
Achilles UTSW 5 121,307,381 (GRCm38) nonsense probably null
agamemnon UTSW 5 121,253,858 (GRCm38) splice site probably benign
clymnestra UTSW 5 121,334,375 (GRCm38) missense possibly damaging 0.86
hector UTSW 5 121,315,437 (GRCm38) missense probably damaging 1.00
helen UTSW 5 121,310,663 (GRCm38) missense probably damaging 0.97
Merriwether UTSW 5 121,353,551 (GRCm38) missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121,333,060 (GRCm38) critical splice donor site probably null
R0018:Hectd4 UTSW 5 121,254,179 (GRCm38) missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121,308,576 (GRCm38) missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121,262,588 (GRCm38) nonsense probably null
R0080:Hectd4 UTSW 5 121,349,372 (GRCm38) missense probably benign 0.18
R0110:Hectd4 UTSW 5 121,305,673 (GRCm38) missense possibly damaging 0.53
R0110:Hectd4 UTSW 5 121,281,896 (GRCm38) missense possibly damaging 0.90
R0115:Hectd4 UTSW 5 121,295,506 (GRCm38) splice site probably benign
R0128:Hectd4 UTSW 5 121,349,243 (GRCm38) missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121,333,024 (GRCm38) missense probably benign 0.44
R0131:Hectd4 UTSW 5 121,333,024 (GRCm38) missense probably benign 0.44
R0132:Hectd4 UTSW 5 121,333,024 (GRCm38) missense probably benign 0.44
R0244:Hectd4 UTSW 5 121,329,605 (GRCm38) missense probably benign 0.33
R0281:Hectd4 UTSW 5 121,254,251 (GRCm38) missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121,259,864 (GRCm38) missense probably benign
R0410:Hectd4 UTSW 5 121,286,266 (GRCm38) missense possibly damaging 0.86
R0422:Hectd4 UTSW 5 121,343,082 (GRCm38) splice site probably null
R0442:Hectd4 UTSW 5 121,323,982 (GRCm38) missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121,364,590 (GRCm38) splice site probably null
R0469:Hectd4 UTSW 5 121,305,673 (GRCm38) missense possibly damaging 0.53
R0469:Hectd4 UTSW 5 121,281,896 (GRCm38) missense possibly damaging 0.90
R0481:Hectd4 UTSW 5 121,295,506 (GRCm38) splice site probably benign
R0510:Hectd4 UTSW 5 121,305,673 (GRCm38) missense possibly damaging 0.53
R0510:Hectd4 UTSW 5 121,281,896 (GRCm38) missense possibly damaging 0.90
R0520:Hectd4 UTSW 5 121,331,707 (GRCm38) missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121,348,476 (GRCm38) missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121,304,337 (GRCm38) missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121,343,232 (GRCm38) splice site probably benign
R0622:Hectd4 UTSW 5 121,348,625 (GRCm38) missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121,277,824 (GRCm38) missense probably benign 0.18
R0708:Hectd4 UTSW 5 121,286,463 (GRCm38) critical splice donor site probably null
R0710:Hectd4 UTSW 5 121,336,628 (GRCm38) missense probably benign 0.08
R0763:Hectd4 UTSW 5 121,307,033 (GRCm38) unclassified probably benign
R0764:Hectd4 UTSW 5 121,286,769 (GRCm38) missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121,286,736 (GRCm38) missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121,310,599 (GRCm38) missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121,350,485 (GRCm38) missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121,321,507 (GRCm38) missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121,318,624 (GRCm38) nonsense probably null
R1391:Hectd4 UTSW 5 121,353,695 (GRCm38) missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121,328,513 (GRCm38) critical splice donor site probably null
R1468:Hectd4 UTSW 5 121,349,172 (GRCm38) missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121,349,172 (GRCm38) missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121,323,956 (GRCm38) missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121,349,259 (GRCm38) missense probably benign 0.00
R1572:Hectd4 UTSW 5 121,301,878 (GRCm38) missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121,317,245 (GRCm38) missense probably benign 0.01
R1705:Hectd4 UTSW 5 121,298,104 (GRCm38) missense probably benign
R1715:Hectd4 UTSW 5 121,344,818 (GRCm38) missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121,301,839 (GRCm38) missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121,349,530 (GRCm38) missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121,358,303 (GRCm38) missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121,291,191 (GRCm38) splice site probably benign
R1784:Hectd4 UTSW 5 121,301,839 (GRCm38) missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121,297,180 (GRCm38) missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121,322,294 (GRCm38) missense probably benign 0.08
R1915:Hectd4 UTSW 5 121,322,294 (GRCm38) missense probably benign 0.08
R2024:Hectd4 UTSW 5 121,281,918 (GRCm38) missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121,355,629 (GRCm38) missense probably benign 0.04
R2108:Hectd4 UTSW 5 121,333,424 (GRCm38) missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121,318,639 (GRCm38) missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121,253,858 (GRCm38) splice site probably benign
R2192:Hectd4 UTSW 5 121,315,143 (GRCm38) missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121,353,537 (GRCm38) missense probably benign 0.18
R2324:Hectd4 UTSW 5 121,315,437 (GRCm38) missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121,320,026 (GRCm38) missense probably benign 0.05
R2504:Hectd4 UTSW 5 121,263,967 (GRCm38) missense possibly damaging 0.73
R2504:Hectd4 UTSW 5 121,220,620 (GRCm38) missense unknown
R2904:Hectd4 UTSW 5 121,292,724 (GRCm38) splice site probably benign
R3843:Hectd4 UTSW 5 121,259,873 (GRCm38) missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121,320,101 (GRCm38) critical splice donor site probably null
R3944:Hectd4 UTSW 5 121,303,525 (GRCm38) splice site probably benign
R4133:Hectd4 UTSW 5 121,277,834 (GRCm38) critical splice donor site probably null
R4271:Hectd4 UTSW 5 121,220,504 (GRCm38) small deletion probably benign
R4413:Hectd4 UTSW 5 121,350,481 (GRCm38) missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121,308,271 (GRCm38) missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121,286,257 (GRCm38) missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121,314,907 (GRCm38) nonsense probably null
R4564:Hectd4 UTSW 5 121,350,431 (GRCm38) missense probably benign 0.33
R4582:Hectd4 UTSW 5 121,286,419 (GRCm38) missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121,297,203 (GRCm38) missense probably benign 0.01
R4633:Hectd4 UTSW 5 121,349,216 (GRCm38) missense probably benign 0.33
R4643:Hectd4 UTSW 5 121,349,055 (GRCm38) missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121,325,251 (GRCm38) missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121,303,615 (GRCm38) missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121,341,977 (GRCm38) missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121,348,442 (GRCm38) missense probably benign
R4781:Hectd4 UTSW 5 121,306,107 (GRCm38) critical splice donor site probably null
R4860:Hectd4 UTSW 5 121,305,818 (GRCm38) missense probably benign 0.04
R4860:Hectd4 UTSW 5 121,305,818 (GRCm38) missense probably benign 0.04
R4869:Hectd4 UTSW 5 121,322,672 (GRCm38) missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121,263,891 (GRCm38) missense probably benign 0.18
R4922:Hectd4 UTSW 5 121,359,315 (GRCm38) missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121,322,690 (GRCm38) missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121,329,565 (GRCm38) missense possibly damaging 0.93
R5004:Hectd4 UTSW 5 121,328,199 (GRCm38) splice site probably null
R5129:Hectd4 UTSW 5 121,343,510 (GRCm38) missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121,353,551 (GRCm38) missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121,344,824 (GRCm38) missense probably benign 0.28
R5344:Hectd4 UTSW 5 121,343,676 (GRCm38) missense probably benign 0.28
R5345:Hectd4 UTSW 5 121,263,974 (GRCm38) missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121,304,448 (GRCm38) missense probably benign 0.33
R5360:Hectd4 UTSW 5 121,315,401 (GRCm38) missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121,310,603 (GRCm38) missense probably benign 0.04
R5445:Hectd4 UTSW 5 121,266,274 (GRCm38) missense probably benign 0.00
R5479:Hectd4 UTSW 5 121,306,948 (GRCm38) missense probably benign
R5507:Hectd4 UTSW 5 121,281,101 (GRCm38) missense unknown
R5552:Hectd4 UTSW 5 121,342,851 (GRCm38) missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121,348,815 (GRCm38) missense possibly damaging 0.85
R5757:Hectd4 UTSW 5 121,348,619 (GRCm38) missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121,307,524 (GRCm38) critical splice donor site probably null
R5869:Hectd4 UTSW 5 121,343,225 (GRCm38) critical splice donor site probably null
R5913:Hectd4 UTSW 5 121,323,974 (GRCm38) missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121,308,271 (GRCm38) missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121,322,294 (GRCm38) missense probably benign 0.01
R6219:Hectd4 UTSW 5 121,308,878 (GRCm38) missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121,339,498 (GRCm38) missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121,254,220 (GRCm38) missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121,350,445 (GRCm38) missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121,334,375 (GRCm38) missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121,350,592 (GRCm38) missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121,356,196 (GRCm38) splice site probably null
R6540:Hectd4 UTSW 5 121,303,571 (GRCm38) missense probably benign 0.33
R6706:Hectd4 UTSW 5 121,320,084 (GRCm38) missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121,307,381 (GRCm38) nonsense probably null
R6736:Hectd4 UTSW 5 121,277,725 (GRCm38) missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121,353,511 (GRCm38) missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121,364,568 (GRCm38) missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121,299,597 (GRCm38) missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121,273,629 (GRCm38) missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121,308,342 (GRCm38) missense probably benign 0.01
R7234:Hectd4 UTSW 5 121,329,073 (GRCm38) missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121,314,881 (GRCm38) missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121,310,663 (GRCm38) missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121,281,932 (GRCm38) missense probably benign 0.00
R7467:Hectd4 UTSW 5 121,323,961 (GRCm38) missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121,358,133 (GRCm38) splice site probably null
R7482:Hectd4 UTSW 5 121,363,878 (GRCm38) missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121,297,109 (GRCm38) missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121,343,665 (GRCm38) missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121,315,510 (GRCm38) splice site probably null
R7560:Hectd4 UTSW 5 121,254,342 (GRCm38) missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121,291,225 (GRCm38) missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121,349,459 (GRCm38) missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121,318,735 (GRCm38) missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121,254,371 (GRCm38) missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121,324,031 (GRCm38) missense probably benign 0.06
R7692:Hectd4 UTSW 5 121,321,564 (GRCm38) missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121,220,617 (GRCm38) missense unknown
R7731:Hectd4 UTSW 5 121,307,014 (GRCm38) missense probably benign 0.00
R7732:Hectd4 UTSW 5 121,336,629 (GRCm38) missense probably benign 0.14
R7782:Hectd4 UTSW 5 121,305,721 (GRCm38) missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121,329,568 (GRCm38) missense probably benign 0.27
R7898:Hectd4 UTSW 5 121,331,817 (GRCm38) missense probably benign 0.18
R7910:Hectd4 UTSW 5 121,254,228 (GRCm38) missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121,310,629 (GRCm38) missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121,339,518 (GRCm38) missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121,321,398 (GRCm38) missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121,332,949 (GRCm38) missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121,286,376 (GRCm38) missense probably benign 0.33
R8171:Hectd4 UTSW 5 121,318,756 (GRCm38) missense possibly damaging 0.82
R8234:Hectd4 UTSW 5 121,339,544 (GRCm38) missense possibly damaging 0.72
R8289:Hectd4 UTSW 5 121,266,361 (GRCm38) missense possibly damaging 0.53
R8292:Hectd4 UTSW 5 121,317,225 (GRCm38) missense possibly damaging 0.66
R8348:Hectd4 UTSW 5 121,220,256 (GRCm38) start gained probably benign
R8397:Hectd4 UTSW 5 121,259,894 (GRCm38) missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121,308,358 (GRCm38) missense possibly damaging 0.90
R8436:Hectd4 UTSW 5 121,343,147 (GRCm38) missense probably benign 0.00
R8443:Hectd4 UTSW 5 121,329,109 (GRCm38) missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121,220,256 (GRCm38) start gained probably benign
R8516:Hectd4 UTSW 5 121,349,010 (GRCm38) missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121,304,426 (GRCm38) nonsense probably null
R8553:Hectd4 UTSW 5 121,353,598 (GRCm38) missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121,310,651 (GRCm38) missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121,350,494 (GRCm38) missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121,363,775 (GRCm38) nonsense probably null
R8769:Hectd4 UTSW 5 121,281,873 (GRCm38) missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121,323,931 (GRCm38) missense probably benign 0.01
R8887:Hectd4 UTSW 5 121,295,478 (GRCm38) missense probably benign 0.44
R8982:Hectd4 UTSW 5 121,328,242 (GRCm38) missense probably benign 0.02
R8988:Hectd4 UTSW 5 121,277,756 (GRCm38) missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121,358,284 (GRCm38) missense probably benign 0.33
R8994:Hectd4 UTSW 5 121,303,566 (GRCm38) missense probably benign 0.33
R8995:Hectd4 UTSW 5 121,254,359 (GRCm38) missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121,313,892 (GRCm38) missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121,273,614 (GRCm38) missense probably benign 0.14
R9106:Hectd4 UTSW 5 121,329,556 (GRCm38) missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121,358,175 (GRCm38) missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121,349,034 (GRCm38) missense probably benign 0.33
R9154:Hectd4 UTSW 5 121,253,904 (GRCm38) missense
R9162:Hectd4 UTSW 5 121,306,979 (GRCm38) missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121,308,627 (GRCm38) missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121,299,488 (GRCm38) missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121,295,433 (GRCm38) missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121,348,965 (GRCm38) missense probably benign 0.14
R9300:Hectd4 UTSW 5 121,348,889 (GRCm38) missense probably benign 0.33
R9314:Hectd4 UTSW 5 121,299,645 (GRCm38) critical splice donor site probably null
R9381:Hectd4 UTSW 5 121,334,429 (GRCm38) missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121,322,801 (GRCm38) missense probably benign 0.01
R9491:Hectd4 UTSW 5 121,314,918 (GRCm38) missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121,364,553 (GRCm38) missense probably benign 0.00
R9557:Hectd4 UTSW 5 121,321,554 (GRCm38) missense possibly damaging 0.66
R9561:Hectd4 UTSW 5 121,334,469 (GRCm38) missense possibly damaging 0.53
R9593:Hectd4 UTSW 5 121,286,781 (GRCm38) nonsense probably null
R9704:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
R9705:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
R9712:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
R9713:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
R9726:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
R9732:Hectd4 UTSW 5 121,254,191 (GRCm38) nonsense probably null
R9750:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
R9752:Hectd4 UTSW 5 121,334,352 (GRCm38) missense possibly damaging 0.85
R9752:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
R9772:Hectd4 UTSW 5 121,310,681 (GRCm38) missense probably benign 0.00
X0026:Hectd4 UTSW 5 121,349,637 (GRCm38) missense probably benign 0.04
X0027:Hectd4 UTSW 5 121,321,404 (GRCm38) missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121,295,503 (GRCm38) splice site probably null
Z1177:Hectd4 UTSW 5 121,358,320 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGACCAGAGGAAATTGATTCTAC -3'
(R):5'- TCTTTGGAGGCCGGACATTG -3'

Sequencing Primer
(F):5'- ATGGTGGCATGCACACACTTC -3'
(R):5'- GGCCGGACATTGGTGAAG -3'
Posted On 2016-11-21