Incidental Mutation 'R5745:3110082I17Rik'
ID445744
Institutional Source Beutler Lab
Gene Symbol 3110082I17Rik
Ensembl Gene ENSMUSG00000053553
Gene NameRIKEN cDNA 3110082I17 gene
Synonyms
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139359739-139460527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139364073 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 74 (R74W)
Ref Sequence ENSEMBL: ENSMUSP00000142949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066052] [ENSMUST00000198474]
Predicted Effect probably damaging
Transcript: ENSMUST00000066052
AA Change: R74W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069230
Gene: ENSMUSG00000053553
AA Change: R74W

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 103 165 3e-26 PFAM
low complexity region 184 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196267
Predicted Effect probably damaging
Transcript: ENSMUST00000198474
AA Change: R74W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142949
Gene: ENSMUSG00000053553
AA Change: R74W

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 102 141 9e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in 3110082I17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0614:3110082I17Rik UTSW 5 139364031 missense possibly damaging 0.54
R0833:3110082I17Rik UTSW 5 139364120 missense possibly damaging 0.54
R0836:3110082I17Rik UTSW 5 139364120 missense possibly damaging 0.54
R3784:3110082I17Rik UTSW 5 139455442 missense probably damaging 0.99
R3787:3110082I17Rik UTSW 5 139455442 missense probably damaging 0.99
R4961:3110082I17Rik UTSW 5 139364100 missense probably damaging 1.00
R7126:3110082I17Rik UTSW 5 139361250 missense unknown
R7129:3110082I17Rik UTSW 5 139363983 missense probably damaging 1.00
R7414:3110082I17Rik UTSW 5 139364024 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACCCCTGCTACAATGGACCAG -3'
(R):5'- TGGTCCGTCCACTTGAAACC -3'

Sequencing Primer
(F):5'- ATGGACCAGCTTCTACCCAGTG -3'
(R):5'- ATCAGCCTCTGAGCTGTGAATAG -3'
Posted On2016-11-21