Incidental Mutation 'R5745:3110082I17Rik'
ID 445744
Institutional Source Beutler Lab
Gene Symbol 3110082I17Rik
Ensembl Gene ENSMUSG00000053553
Gene Name RIKEN cDNA 3110082I17 gene
Synonyms
MMRRC Submission 043198-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 139345494-139446282 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139349828 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 74 (R74W)
Ref Sequence ENSEMBL: ENSMUSP00000142949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066052] [ENSMUST00000198474]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000066052
AA Change: R74W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069230
Gene: ENSMUSG00000053553
AA Change: R74W

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 103 165 3e-26 PFAM
low complexity region 184 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196267
Predicted Effect probably damaging
Transcript: ENSMUST00000198474
AA Change: R74W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142949
Gene: ENSMUSG00000053553
AA Change: R74W

DomainStartEndE-ValueType
low complexity region 54 77 N/A INTRINSIC
Pfam:DUF2373 102 141 9e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T G 1: 85,858,995 (GRCm39) probably null Het
Adcy8 A T 15: 64,792,320 (GRCm39) I212N possibly damaging Het
Cobll1 T C 2: 64,928,801 (GRCm39) T879A probably damaging Het
Copb2 T C 9: 98,456,164 (GRCm39) S233P probably damaging Het
Cpa5 T A 6: 30,630,436 (GRCm39) M330K probably damaging Het
Dgcr8 A T 16: 18,098,307 (GRCm39) N361K probably benign Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dock8 T A 19: 25,107,761 (GRCm39) N830K probably benign Het
Ephb1 C T 9: 102,072,633 (GRCm39) D49N probably benign Het
Fer1l6 A G 15: 58,443,238 (GRCm39) I514V probably benign Het
Fpr1 A G 17: 18,097,344 (GRCm39) I215T probably benign Het
Hectd4 G A 5: 121,491,565 (GRCm39) V3668M possibly damaging Het
Ighv3-4 T A 12: 114,217,388 (GRCm39) I68L probably benign Het
Intu A G 3: 40,647,402 (GRCm39) probably null Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Mycbp2 A C 14: 103,393,889 (GRCm39) S2781A possibly damaging Het
Myom2 T A 8: 15,172,705 (GRCm39) S1211T probably benign Het
Nrp1 A T 8: 129,194,929 (GRCm39) I462F probably benign Het
Or10d3 T C 9: 39,461,987 (GRCm39) Y60C probably damaging Het
Or6c5c T A 10: 129,299,307 (GRCm39) I254N probably damaging Het
Pcsk1 A C 13: 75,280,079 (GRCm39) S635R probably benign Het
Pms1 A T 1: 53,246,861 (GRCm39) Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Sema3b C A 9: 107,478,628 (GRCm39) A356S probably damaging Het
Shoc2 C A 19: 54,018,323 (GRCm39) T485K probably benign Het
Slc7a7 G A 14: 54,615,292 (GRCm39) S235L possibly damaging Het
Smcr8 A T 11: 60,674,977 (GRCm39) T918S probably benign Het
Tafa1 G A 6: 96,626,146 (GRCm39) R128Q probably damaging Het
Tle3 C A 9: 61,322,133 (GRCm39) F719L probably damaging Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Other mutations in 3110082I17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0614:3110082I17Rik UTSW 5 139,349,786 (GRCm39) missense possibly damaging 0.54
R0833:3110082I17Rik UTSW 5 139,349,875 (GRCm39) missense possibly damaging 0.54
R0836:3110082I17Rik UTSW 5 139,349,875 (GRCm39) missense possibly damaging 0.54
R3784:3110082I17Rik UTSW 5 139,441,197 (GRCm39) missense probably damaging 0.99
R3787:3110082I17Rik UTSW 5 139,441,197 (GRCm39) missense probably damaging 0.99
R4961:3110082I17Rik UTSW 5 139,349,855 (GRCm39) missense probably damaging 1.00
R7126:3110082I17Rik UTSW 5 139,347,005 (GRCm39) missense unknown
R7129:3110082I17Rik UTSW 5 139,349,738 (GRCm39) missense probably damaging 1.00
R7414:3110082I17Rik UTSW 5 139,349,779 (GRCm39) missense probably damaging 0.99
R7934:3110082I17Rik UTSW 5 139,349,770 (GRCm39) missense probably benign 0.24
R8169:3110082I17Rik UTSW 5 139,349,812 (GRCm39) missense probably damaging 1.00
R8861:3110082I17Rik UTSW 5 139,396,642 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- TTACCCCTGCTACAATGGACCAG -3'
(R):5'- TGGTCCGTCCACTTGAAACC -3'

Sequencing Primer
(F):5'- ATGGACCAGCTTCTACCCAGTG -3'
(R):5'- ATCAGCCTCTGAGCTGTGAATAG -3'
Posted On 2016-11-21