Incidental Mutation 'R5745:Cpa5'
ID 445745
Institutional Source Beutler Lab
Gene Symbol Cpa5
Ensembl Gene ENSMUSG00000029788
Gene Name carboxypeptidase A5
Synonyms 4930430M09Rik
MMRRC Submission 043198-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 30611009-30631744 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30630436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 330 (M330K)
Ref Sequence ENSEMBL: ENSMUSP00000110792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062758] [ENSMUST00000115138] [ENSMUST00000115139] [ENSMUST00000165949]
AlphaFold Q8R4H4
Predicted Effect probably damaging
Transcript: ENSMUST00000062758
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057722
Gene: ENSMUSG00000029788
AA Change: M330K

DomainStartEndE-ValueType
Pfam:Propep_M14 43 117 5.6e-23 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115138
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110791
Gene: ENSMUSG00000029788
AA Change: M330K

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 9.9e-26 PFAM
Zn_pept 139 395 4.62e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115139
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110792
Gene: ENSMUSG00000029788
AA Change: M330K

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 4.6e-25 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165949
AA Change: C286S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000126436
Gene: ENSMUSG00000029788
AA Change: C286S

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 6.4e-26 PFAM
Zn_pept 139 309 3.6e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed in mouse testes where the encoded protein is localized to the germ cells. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,828 (GRCm39) R74W probably damaging Het
4933407L21Rik T G 1: 85,858,995 (GRCm39) probably null Het
Adcy8 A T 15: 64,792,320 (GRCm39) I212N possibly damaging Het
Cobll1 T C 2: 64,928,801 (GRCm39) T879A probably damaging Het
Copb2 T C 9: 98,456,164 (GRCm39) S233P probably damaging Het
Dgcr8 A T 16: 18,098,307 (GRCm39) N361K probably benign Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dock8 T A 19: 25,107,761 (GRCm39) N830K probably benign Het
Ephb1 C T 9: 102,072,633 (GRCm39) D49N probably benign Het
Fer1l6 A G 15: 58,443,238 (GRCm39) I514V probably benign Het
Fpr1 A G 17: 18,097,344 (GRCm39) I215T probably benign Het
Hectd4 G A 5: 121,491,565 (GRCm39) V3668M possibly damaging Het
Ighv3-4 T A 12: 114,217,388 (GRCm39) I68L probably benign Het
Intu A G 3: 40,647,402 (GRCm39) probably null Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Mycbp2 A C 14: 103,393,889 (GRCm39) S2781A possibly damaging Het
Myom2 T A 8: 15,172,705 (GRCm39) S1211T probably benign Het
Nrp1 A T 8: 129,194,929 (GRCm39) I462F probably benign Het
Or10d3 T C 9: 39,461,987 (GRCm39) Y60C probably damaging Het
Or6c5c T A 10: 129,299,307 (GRCm39) I254N probably damaging Het
Pcsk1 A C 13: 75,280,079 (GRCm39) S635R probably benign Het
Pms1 A T 1: 53,246,861 (GRCm39) Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Sema3b C A 9: 107,478,628 (GRCm39) A356S probably damaging Het
Shoc2 C A 19: 54,018,323 (GRCm39) T485K probably benign Het
Slc7a7 G A 14: 54,615,292 (GRCm39) S235L possibly damaging Het
Smcr8 A T 11: 60,674,977 (GRCm39) T918S probably benign Het
Tafa1 G A 6: 96,626,146 (GRCm39) R128Q probably damaging Het
Tle3 C A 9: 61,322,133 (GRCm39) F719L probably damaging Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Other mutations in Cpa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cpa5 APN 6 30,625,926 (GRCm39) splice site probably benign
IGL02577:Cpa5 APN 6 30,626,807 (GRCm39) splice site probably benign
IGL03148:Cpa5 APN 6 30,630,436 (GRCm39) missense probably damaging 1.00
IGL03341:Cpa5 APN 6 30,626,290 (GRCm39) missense possibly damaging 0.57
R0836:Cpa5 UTSW 6 30,623,210 (GRCm39) missense probably damaging 1.00
R1437:Cpa5 UTSW 6 30,624,654 (GRCm39) missense probably damaging 1.00
R2146:Cpa5 UTSW 6 30,626,821 (GRCm39) missense probably damaging 1.00
R2285:Cpa5 UTSW 6 30,615,063 (GRCm39) missense probably benign 0.09
R2334:Cpa5 UTSW 6 30,624,605 (GRCm39) nonsense probably null
R4081:Cpa5 UTSW 6 30,631,228 (GRCm39) missense probably benign 0.02
R4454:Cpa5 UTSW 6 30,626,323 (GRCm39) missense possibly damaging 0.84
R4483:Cpa5 UTSW 6 30,624,625 (GRCm39) missense probably damaging 1.00
R4758:Cpa5 UTSW 6 30,615,159 (GRCm39) missense possibly damaging 0.67
R4771:Cpa5 UTSW 6 30,612,684 (GRCm39) nonsense probably null
R4953:Cpa5 UTSW 6 30,631,363 (GRCm39) missense possibly damaging 0.84
R5053:Cpa5 UTSW 6 30,623,271 (GRCm39) missense probably damaging 1.00
R5392:Cpa5 UTSW 6 30,630,829 (GRCm39) nonsense probably null
R5593:Cpa5 UTSW 6 30,630,848 (GRCm39) missense probably benign 0.10
R5900:Cpa5 UTSW 6 30,615,115 (GRCm39) missense probably damaging 1.00
R6264:Cpa5 UTSW 6 30,613,984 (GRCm39) missense probably damaging 1.00
R6268:Cpa5 UTSW 6 30,615,172 (GRCm39) missense probably damaging 1.00
R6376:Cpa5 UTSW 6 30,614,044 (GRCm39) missense probably benign
R6634:Cpa5 UTSW 6 30,626,363 (GRCm39) missense probably damaging 1.00
R6814:Cpa5 UTSW 6 30,614,053 (GRCm39) missense probably benign 0.03
R6872:Cpa5 UTSW 6 30,614,053 (GRCm39) missense probably benign 0.03
R6989:Cpa5 UTSW 6 30,625,891 (GRCm39) missense probably benign 0.06
R7205:Cpa5 UTSW 6 30,630,829 (GRCm39) missense probably benign
R7499:Cpa5 UTSW 6 30,630,856 (GRCm39) missense possibly damaging 0.81
R7864:Cpa5 UTSW 6 30,631,394 (GRCm39) missense probably damaging 0.97
R8170:Cpa5 UTSW 6 30,624,594 (GRCm39) missense probably benign 0.35
R9027:Cpa5 UTSW 6 30,612,604 (GRCm39) start codon destroyed probably null 0.88
R9395:Cpa5 UTSW 6 30,631,280 (GRCm39) missense probably damaging 1.00
R9607:Cpa5 UTSW 6 30,626,338 (GRCm39) missense probably damaging 1.00
R9687:Cpa5 UTSW 6 30,614,041 (GRCm39) missense probably benign
R9794:Cpa5 UTSW 6 30,625,920 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGGGCACTTTAATCCACTG -3'
(R):5'- GGGAACAACTCTACTGATTCTTCC -3'

Sequencing Primer
(F):5'- CACTGGGTGGTTTTATTTTGCTTCC -3'
(R):5'- ACTGATTCTTCCTACCATGGAC -3'
Posted On 2016-11-21