Incidental Mutation 'R5745:Cpa5'
ID445745
Institutional Source Beutler Lab
Gene Symbol Cpa5
Ensembl Gene ENSMUSG00000029788
Gene Namecarboxypeptidase A5
Synonyms
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30611010-30631745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30630437 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 330 (M330K)
Ref Sequence ENSEMBL: ENSMUSP00000110792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062758] [ENSMUST00000115138] [ENSMUST00000115139] [ENSMUST00000165949]
Predicted Effect probably damaging
Transcript: ENSMUST00000062758
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057722
Gene: ENSMUSG00000029788
AA Change: M330K

DomainStartEndE-ValueType
Pfam:Propep_M14 43 117 5.6e-23 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115138
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110791
Gene: ENSMUSG00000029788
AA Change: M330K

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 9.9e-26 PFAM
Zn_pept 139 395 4.62e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115139
AA Change: M330K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110792
Gene: ENSMUSG00000029788
AA Change: M330K

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 4.6e-25 PFAM
Zn_pept 139 419 4.83e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165949
AA Change: C286S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000126436
Gene: ENSMUSG00000029788
AA Change: C286S

DomainStartEndE-ValueType
Pfam:Propep_M14 43 118 6.4e-26 PFAM
Zn_pept 139 309 3.6e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. The encoded preproprotein undergoes proteolytic processing that removes the N-terminal activation peptide to generate a functional enzyme. This gene is expressed in mouse testes where the encoded protein is localized to the germ cells. This gene is located in a cluster of carboxypeptidase genes on chromosome 6. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Cpa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cpa5 APN 6 30625927 splice site probably benign
IGL02577:Cpa5 APN 6 30626808 splice site probably benign
IGL03148:Cpa5 APN 6 30630437 missense probably damaging 1.00
IGL03341:Cpa5 APN 6 30626291 missense possibly damaging 0.57
R0836:Cpa5 UTSW 6 30623211 missense probably damaging 1.00
R1437:Cpa5 UTSW 6 30624655 missense probably damaging 1.00
R2146:Cpa5 UTSW 6 30626822 missense probably damaging 1.00
R2285:Cpa5 UTSW 6 30615064 missense probably benign 0.09
R2334:Cpa5 UTSW 6 30624606 nonsense probably null
R4081:Cpa5 UTSW 6 30631229 missense probably benign 0.02
R4454:Cpa5 UTSW 6 30626324 missense possibly damaging 0.84
R4483:Cpa5 UTSW 6 30624626 missense probably damaging 1.00
R4758:Cpa5 UTSW 6 30615160 missense possibly damaging 0.67
R4771:Cpa5 UTSW 6 30612685 nonsense probably null
R4953:Cpa5 UTSW 6 30631364 missense possibly damaging 0.84
R5053:Cpa5 UTSW 6 30623272 missense probably damaging 1.00
R5392:Cpa5 UTSW 6 30630830 nonsense probably null
R5593:Cpa5 UTSW 6 30630849 missense probably benign 0.10
R5900:Cpa5 UTSW 6 30615116 missense probably damaging 1.00
R6264:Cpa5 UTSW 6 30613985 missense probably damaging 1.00
R6268:Cpa5 UTSW 6 30615173 missense probably damaging 1.00
R6376:Cpa5 UTSW 6 30614045 missense probably benign
R6634:Cpa5 UTSW 6 30626364 missense probably damaging 1.00
R6814:Cpa5 UTSW 6 30614054 missense probably benign 0.03
R6872:Cpa5 UTSW 6 30614054 missense probably benign 0.03
R6989:Cpa5 UTSW 6 30625892 missense probably benign 0.06
R7205:Cpa5 UTSW 6 30630830 missense probably benign
R7499:Cpa5 UTSW 6 30630857 missense possibly damaging 0.81
R7864:Cpa5 UTSW 6 30631395 missense probably damaging 0.97
R7947:Cpa5 UTSW 6 30631395 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCTGGGCACTTTAATCCACTG -3'
(R):5'- GGGAACAACTCTACTGATTCTTCC -3'

Sequencing Primer
(F):5'- CACTGGGTGGTTTTATTTTGCTTCC -3'
(R):5'- ACTGATTCTTCCTACCATGGAC -3'
Posted On2016-11-21