Mutagenetix > Incidental Mutation

Incidental Mutation 'R5745:Kel'

445746

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

043198-MU

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R5745 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 41699027 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 243 (G243E)

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899]

AlphaFold

Q9EQF2

Predicted Effect

probably damaging
Transcript: ENSMUST00000031899
AA Change: G243E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: G243E

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000192118
AA Change: G18E

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192406

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	G	A	5: 139,364,073	R74W	probably damaging	Het
4933407L21Rik	T	G	1: 85,931,274		probably null	Het
Adcy8	A	T	15: 64,920,471	I212N	possibly damaging	Het
Cobll1	T	C	2: 65,098,457	T879A	probably damaging	Het
Copb2	T	C	9: 98,574,111	S233P	probably damaging	Het
Cpa5	T	A	6: 30,630,437	M330K	probably damaging	Het
Dgcr8	A	T	16: 18,280,443	N361K	probably benign	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dock8	T	A	19: 25,130,397	N830K	probably benign	Het
Ephb1	C	T	9: 102,195,434	D49N	probably benign	Het
Fam19a1	G	A	6: 96,649,185	R128Q	probably damaging	Het
Fer1l6	A	G	15: 58,571,389	I514V	probably benign	Het
Fpr1	A	G	17: 17,877,082	I215T	probably benign	Het
Hectd4	G	A	5: 121,353,502	V3668M	possibly damaging	Het
Ighv3-4	T	A	12: 114,253,768	I68L	probably benign	Het
Intu	A	G	3: 40,692,972		probably null	Het
Mycbp2	A	C	14: 103,156,453	S2781A	possibly damaging	Het
Myom2	T	A	8: 15,122,705	S1211T	probably benign	Het
Nrp1	A	T	8: 128,468,448	I462F	probably benign	Het
Olfr787	T	A	10: 129,463,438	I254N	probably damaging	Het
Olfr958	T	C	9: 39,550,691	Y60C	probably damaging	Het
Pcsk1	A	C	13: 75,131,960	S635R	probably benign	Het
Pms1	A	T	1: 53,207,702	Y280*	probably null	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,920		probably benign	Het
Sema3b	C	A	9: 107,601,429	A356S	probably damaging	Het
Shoc2	C	A	19: 54,029,892	T485K	probably benign	Het
Slc7a7	G	A	14: 54,377,835	S235L	possibly damaging	Het
Smcr8	A	T	11: 60,784,151	T918S	probably benign	Het
Tle3	C	A	9: 61,414,851	F719L	probably damaging	Het
Vmn2r45	T	A	7: 8,483,075	I405L	probably benign	Het
Vmn2r57	A	T	7: 41,448,471	H57Q	possibly damaging	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R7938:Kel	UTSW	6	41698376	missense	probably benign	0.06
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
R9158:Kel	UTSW	6	41687971	missense	probably benign	0.10
R9518:Kel	UTSW	6	41702400	missense	probably damaging	1.00
R9726:Kel	UTSW	6	41702037	missense	probably damaging	1.00
R9769:Kel	UTSW	6	41702056	missense	probably damaging	1.00
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTTTGAGAGACCATCAAGCACAG -3'
(R):5'- TTGTGTCCAGATAGACCAGCC -3'

Sequencing Primer
(F):5'- GAGTCCCCAGACCCTCAG -3'
(R):5'- TAGACCAGCCGGAGTTTGACATTC -3'

Posted On

2016-11-21