Mutagenetix > Incidental Mutation

Incidental Mutation 'R5745:Vmn2r45'

445747

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r45

Ensembl Gene

ENSMUSG00000090662

Gene Name

vomeronasal 2, receptor 45

Synonyms

MMRRC Submission

043198-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R5745 (G1)

Quality Score

126

Status

Not validated

Chromosome

Chromosomal Location

8470525-8489075 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8483075 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 405 (I405L)

Ref Sequence

ENSEMBL: ENSMUSP00000129466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164845]

AlphaFold

L7N2B5

Predicted Effect

probably benign
Transcript: ENSMUST00000164845
AA Change: I405L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129466
Gene: ENSMUSG00000090662
AA Change: I405L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	154	469	4.5e-26	PFAM
Pfam:NCD3G	512	565	6.4e-21	PFAM
Pfam:7tm_3	598	833	2.1e-54	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	G	A	5: 139,364,073	R74W	probably damaging	Het
4933407L21Rik	T	G	1: 85,931,274		probably null	Het
Adcy8	A	T	15: 64,920,471	I212N	possibly damaging	Het
Cobll1	T	C	2: 65,098,457	T879A	probably damaging	Het
Copb2	T	C	9: 98,574,111	S233P	probably damaging	Het
Cpa5	T	A	6: 30,630,437	M330K	probably damaging	Het
Dgcr8	A	T	16: 18,280,443	N361K	probably benign	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dock8	T	A	19: 25,130,397	N830K	probably benign	Het
Ephb1	C	T	9: 102,195,434	D49N	probably benign	Het
Fam19a1	G	A	6: 96,649,185	R128Q	probably damaging	Het
Fer1l6	A	G	15: 58,571,389	I514V	probably benign	Het
Fpr1	A	G	17: 17,877,082	I215T	probably benign	Het
Hectd4	G	A	5: 121,353,502	V3668M	possibly damaging	Het
Ighv3-4	T	A	12: 114,253,768	I68L	probably benign	Het
Intu	A	G	3: 40,692,972		probably null	Het
Kel	C	T	6: 41,699,027	G243E	probably damaging	Het
Mycbp2	A	C	14: 103,156,453	S2781A	possibly damaging	Het
Myom2	T	A	8: 15,122,705	S1211T	probably benign	Het
Nrp1	A	T	8: 128,468,448	I462F	probably benign	Het
Olfr787	T	A	10: 129,463,438	I254N	probably damaging	Het
Olfr958	T	C	9: 39,550,691	Y60C	probably damaging	Het
Pcsk1	A	C	13: 75,131,960	S635R	probably benign	Het
Pms1	A	T	1: 53,207,702	Y280*	probably null	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,920		probably benign	Het
Sema3b	C	A	9: 107,601,429	A356S	probably damaging	Het
Shoc2	C	A	19: 54,029,892	T485K	probably benign	Het
Slc7a7	G	A	14: 54,377,835	S235L	possibly damaging	Het
Smcr8	A	T	11: 60,784,151	T918S	probably benign	Het
Tle3	C	A	9: 61,414,851	F719L	probably damaging	Het
Vmn2r57	A	T	7: 41,448,471	H57Q	possibly damaging	Het

Other mutations in Vmn2r45

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01287:Vmn2r45	APN	7	8485623	missense	probably benign	0.00
IGL01322:Vmn2r45	APN	7	8481333	missense	possibly damaging	0.49
IGL01402:Vmn2r45	APN	7	8481468	missense	probably damaging	0.98
IGL01404:Vmn2r45	APN	7	8481468	missense	probably damaging	0.98
IGL01529:Vmn2r45	APN	7	8483494	missense	probably benign
IGL01596:Vmn2r45	APN	7	8483273	missense	probably damaging	0.98
IGL01646:Vmn2r45	APN	7	8483338	missense	probably benign	0.18
IGL01819:Vmn2r45	APN	7	8485557	missense	probably benign	0.00
IGL02096:Vmn2r45	APN	7	8481444	missense	probably damaging	0.99
IGL02130:Vmn2r45	APN	7	8483557	missense	possibly damaging	0.46
IGL02409:Vmn2r45	APN	7	8485728	missense	probably benign	0.03
IGL02517:Vmn2r45	APN	7	8483186	nonsense	probably null
IGL02633:Vmn2r45	APN	7	8485729	missense	probably benign	0.01
IGL02940:Vmn2r45	APN	7	8472370	missense	probably damaging	0.99
IGL03281:Vmn2r45	APN	7	8483604	missense	probably damaging	1.00
IGL03358:Vmn2r45	APN	7	8471716	missense	probably damaging	1.00
BB004:Vmn2r45	UTSW	7	8483514	missense	probably benign
BB014:Vmn2r45	UTSW	7	8483514	missense	probably benign
R0382:Vmn2r45	UTSW	7	8483099	missense	probably benign	0.06
R0532:Vmn2r45	UTSW	7	8471821	missense	probably damaging	0.99
R0932:Vmn2r45	UTSW	7	8475381	missense	probably damaging	1.00
R1125:Vmn2r45	UTSW	7	8485543	missense	probably benign	0.00
R1580:Vmn2r45	UTSW	7	8471747	missense	possibly damaging	0.95
R1817:Vmn2r45	UTSW	7	8472373	missense	probably damaging	1.00
R1996:Vmn2r45	UTSW	7	8472025	missense	probably damaging	1.00
R2050:Vmn2r45	UTSW	7	8472022	missense	probably damaging	1.00
R2284:Vmn2r45	UTSW	7	8485766	missense	probably benign	0.02
R4019:Vmn2r45	UTSW	7	8471581	nonsense	probably null
R4227:Vmn2r45	UTSW	7	8483278	missense	probably damaging	0.98
R4381:Vmn2r45	UTSW	7	8471913	nonsense	probably null
R4618:Vmn2r45	UTSW	7	8483437	missense	probably benign	0.00
R4624:Vmn2r45	UTSW	7	8481342	missense	probably damaging	1.00
R4704:Vmn2r45	UTSW	7	8483536	nonsense	probably null
R4735:Vmn2r45	UTSW	7	8483473	missense	probably damaging	1.00
R4868:Vmn2r45	UTSW	7	8481481	missense	probably benign	0.06
R4983:Vmn2r45	UTSW	7	8483117	missense	probably damaging	0.99
R5246:Vmn2r45	UTSW	7	8483252	missense	probably benign	0.00
R5430:Vmn2r45	UTSW	7	8483334	nonsense	probably null
R5504:Vmn2r45	UTSW	7	8483177	missense	probably benign	0.03
R5511:Vmn2r45	UTSW	7	8471833	missense	probably benign	0.19
R5814:Vmn2r45	UTSW	7	8471476	missense	probably benign	0.00
R6223:Vmn2r45	UTSW	7	8483302	missense	probably benign
R6267:Vmn2r45	UTSW	7	8472208	missense	probably benign	0.26
R6623:Vmn2r45	UTSW	7	8471501	missense	probably benign	0.09
R6999:Vmn2r45	UTSW	7	8483220	missense	probably benign
R7242:Vmn2r45	UTSW	7	8485613	nonsense	probably null
R7491:Vmn2r45	UTSW	7	8481343	missense	probably benign	0.27
R7620:Vmn2r45	UTSW	7	8483223	nonsense	probably null
R7719:Vmn2r45	UTSW	7	8483461	missense	probably damaging	0.99
R7720:Vmn2r45	UTSW	7	8483461	missense	probably damaging	0.99
R7853:Vmn2r45	UTSW	7	8482988	missense	possibly damaging	0.90
R7873:Vmn2r45	UTSW	7	8483075	missense	probably benign	0.00
R7882:Vmn2r45	UTSW	7	8483410	missense	possibly damaging	0.82
R7927:Vmn2r45	UTSW	7	8483514	missense	probably benign
R8684:Vmn2r45	UTSW	7	8483512	missense	probably damaging	0.99
R8780:Vmn2r45	UTSW	7	8481372	missense	possibly damaging	0.94
R8811:Vmn2r45	UTSW	7	8471882	missense	probably damaging	1.00
R8893:Vmn2r45	UTSW	7	8485620	missense	probably damaging	1.00
R9043:Vmn2r45	UTSW	7	8471905	missense	possibly damaging	0.92
R9208:Vmn2r45	UTSW	7	8483299	missense	probably damaging	1.00
R9327:Vmn2r45	UTSW	7	8471533	missense	probably damaging	1.00
R9586:Vmn2r45	UTSW	7	8483051	missense	probably benign	0.01
R9599:Vmn2r45	UTSW	7	8475458	critical splice acceptor site	probably null
U24488:Vmn2r45	UTSW	7	8472362	missense	probably damaging	1.00
Z1088:Vmn2r45	UTSW	7	8471485	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TTGTGTGCTCTGTATAAAACCACAC -3'
(R):5'- TGGTTCCATCTCAGAAACACAG -3'

Sequencing Primer
(F):5'- ACCACACATTTTCATTGCTAATCTG -3'
(R):5'- TGAAGACTCAGCATCTACC -3'

Posted On

2016-11-21