Incidental Mutation 'R5745:Vmn2r57'
ID445748
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Namevomeronasal 2, receptor 57
SynonymsEG269902
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location41399732-41448641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41448471 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 57 (H57Q)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect possibly damaging
Transcript: ENSMUST00000165029
AA Change: H57Q

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: H57Q

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41428785 missense probably benign
IGL01108:Vmn2r57 APN 7 41427584 missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41425043 missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41399946 missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41400195 missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41400450 missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41428226 missense probably benign
IGL02801:Vmn2r57 APN 7 41448632 missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41428074 missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41399741 missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41400652 missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41399733 splice site probably null
R0305:Vmn2r57 UTSW 7 41427543 missense probably benign 0.00
R0469:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41428801 missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41427804 missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41428211 missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41427830 missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41400124 missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41400643 missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41428107 missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41448577 missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41428825 critical splice acceptor site probably null
R2242:Vmn2r57 UTSW 7 41428074 missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41400195 missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41428130 missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41428239 missense probably benign
R4423:Vmn2r57 UTSW 7 41426640 missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41400468 missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41400495 missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41428662 missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41426550 critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41400240 missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41427939 missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41399974 missense probably damaging 0.99
R6051:Vmn2r57 UTSW 7 41448472 missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41428690 missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41399860 missense probably benign
R6381:Vmn2r57 UTSW 7 41428818 missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41428665 missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41399794 missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41400286 missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41426724 missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41425089 missense possibly damaging 0.76
R7811:Vmn2r57 UTSW 7 41425015 nonsense probably null
X0026:Vmn2r57 UTSW 7 41428125 missense probably benign 0.03
X0026:Vmn2r57 UTSW 7 41428561 missense possibly damaging 0.91
X0065:Vmn2r57 UTSW 7 41427971 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCTCAGAAGTACCAGATCATACTTAG -3'
(R):5'- ATCCATCAGTCTTATGGATGGGC -3'

Sequencing Primer
(F):5'- TCAATTCATCTGGCATTACAAGC -3'
(R):5'- CCATCAGTCTTATGGATGGGCATATG -3'
Posted On2016-11-21