Incidental Mutation 'R5745:Olfr958'
ID445753
Institutional Source Beutler Lab
Gene Symbol Olfr958
Ensembl Gene ENSMUSG00000050853
Gene Nameolfactory receptor 958
SynonymsMOR224-9, GA_x6K02T2PVTD-33247839-33246901
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39547958-39554054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39550691 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000149788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062545] [ENSMUST00000215505] [ENSMUST00000217227]
Predicted Effect probably damaging
Transcript: ENSMUST00000062545
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049930
Gene: ENSMUSG00000050853
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 236 1.5e-6 PFAM
Pfam:7tm_1 41 288 3.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215505
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217227
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Olfr958
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0446:Olfr958 UTSW 9 39550451 missense probably damaging 0.96
R0539:Olfr958 UTSW 9 39550297 missense probably damaging 0.99
R1512:Olfr958 UTSW 9 39550094 missense probably damaging 1.00
R1521:Olfr958 UTSW 9 39550784 missense possibly damaging 0.65
R1652:Olfr958 UTSW 9 39550295 missense probably benign 0.03
R2099:Olfr958 UTSW 9 39550667 missense probably benign 0.17
R2252:Olfr958 UTSW 9 39549977 missense probably damaging 0.99
R2911:Olfr958 UTSW 9 39550821 missense possibly damaging 0.76
R3722:Olfr958 UTSW 9 39550122 missense probably damaging 1.00
R6460:Olfr958 UTSW 9 39550792 frame shift probably null
R6504:Olfr958 UTSW 9 39550278 missense probably damaging 1.00
R7063:Olfr958 UTSW 9 39550115 missense possibly damaging 0.87
R7162:Olfr958 UTSW 9 39550229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCGGTCATAGGCCATCAC -3'
(R):5'- AGACTTTCTCCACCACCGATG -3'

Sequencing Primer
(F):5'- GGTCATAGGCCATCACTGTATAC -3'
(R):5'- CCTGGAGCTGCCTTTCATGG -3'
Posted On2016-11-21