Incidental Mutation 'R5745:Tle3'
ID 445754
Institutional Source Beutler Lab
Gene Symbol Tle3
Ensembl Gene ENSMUSG00000032280
Gene Name transducin-like enhancer of split 3
Synonyms 2610103N05Rik, ESG, Grg3a, Grg3b
MMRRC Submission 043198-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 61279648-61325779 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 61322133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 719 (F719L)
Ref Sequence ENSEMBL: ENSMUSP00000136010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034820] [ENSMUST00000159050] [ENSMUST00000159386] [ENSMUST00000159630] [ENSMUST00000160882] [ENSMUST00000162127] [ENSMUST00000161207] [ENSMUST00000161689] [ENSMUST00000162973] [ENSMUST00000178113] [ENSMUST00000162583]
AlphaFold Q08122
Predicted Effect probably damaging
Transcript: ENSMUST00000034820
AA Change: F700L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034820
Gene: ENSMUSG00000032280
AA Change: F700L

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 4.3e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 468 505 2.96e-2 SMART
WD40 511 552 4.48e-2 SMART
WD40 557 596 2.84e-4 SMART
WD40 599 638 7.55e-9 SMART
WD40 641 679 3.07e1 SMART
WD40 681 720 4.18e-2 SMART
WD40 721 761 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159050
AA Change: F703L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125032
Gene: ENSMUSG00000032280
AA Change: F703L

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 471 508 2.96e-2 SMART
WD40 514 555 4.48e-2 SMART
WD40 560 599 2.84e-4 SMART
WD40 602 641 7.55e-9 SMART
WD40 644 682 3.07e1 SMART
WD40 684 723 4.18e-2 SMART
WD40 724 764 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159140
Predicted Effect probably damaging
Transcript: ENSMUST00000159386
AA Change: F696L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125049
Gene: ENSMUSG00000032280
AA Change: F696L

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 464 501 2.96e-2 SMART
WD40 507 548 4.48e-2 SMART
WD40 553 592 2.84e-4 SMART
WD40 595 634 7.55e-9 SMART
WD40 637 675 3.07e1 SMART
WD40 677 716 4.18e-2 SMART
WD40 717 757 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159630
AA Change: F648L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123723
Gene: ENSMUSG00000032280
AA Change: F648L

DomainStartEndE-ValueType
Pfam:TLE_N 1 79 1.7e-43 PFAM
low complexity region 104 122 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
low complexity region 226 245 N/A INTRINSIC
WD40 416 453 2.96e-2 SMART
WD40 459 500 4.48e-2 SMART
WD40 505 544 2.84e-4 SMART
WD40 547 586 7.55e-9 SMART
WD40 589 627 3.07e1 SMART
WD40 629 668 4.18e-2 SMART
WD40 669 709 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160882
AA Change: F718L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124131
Gene: ENSMUSG00000032280
AA Change: F718L

DomainStartEndE-ValueType
Pfam:TLE_N 1 146 4.8e-76 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
low complexity region 293 312 N/A INTRINSIC
WD40 486 523 2.96e-2 SMART
WD40 529 570 4.48e-2 SMART
WD40 575 614 2.84e-4 SMART
WD40 617 656 7.55e-9 SMART
WD40 659 697 3.07e1 SMART
WD40 699 738 4.18e-2 SMART
WD40 739 779 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162127
AA Change: F638L

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124150
Gene: ENSMUSG00000032280
AA Change: F638L

DomainStartEndE-ValueType
Pfam:TLE_N 1 83 1.2e-37 PFAM
low complexity region 108 126 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
WD40 406 443 2.96e-2 SMART
WD40 449 490 4.48e-2 SMART
WD40 495 534 2.84e-4 SMART
WD40 537 576 7.55e-9 SMART
WD40 579 617 3.07e1 SMART
WD40 619 658 4.18e-2 SMART
WD40 659 699 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161207
AA Change: F698L

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124557
Gene: ENSMUSG00000032280
AA Change: F698L

DomainStartEndE-ValueType
Pfam:TLE_N 1 129 1e-73 PFAM
low complexity region 154 172 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
WD40 466 503 2.96e-2 SMART
WD40 509 550 4.48e-2 SMART
WD40 555 594 2.84e-4 SMART
WD40 597 636 7.55e-9 SMART
WD40 639 677 3.07e1 SMART
WD40 679 718 4.18e-2 SMART
WD40 719 759 1.79e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161689
AA Change: F652L

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125011
Gene: ENSMUSG00000032280
AA Change: F652L

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 4.8e-44 PFAM
low complexity region 105 123 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 227 246 N/A INTRINSIC
WD40 420 457 2.96e-2 SMART
WD40 463 504 4.48e-2 SMART
WD40 509 548 2.84e-4 SMART
WD40 551 590 7.55e-9 SMART
WD40 593 631 3.07e1 SMART
WD40 633 672 4.18e-2 SMART
WD40 673 713 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162973
AA Change: F708L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124173
Gene: ENSMUSG00000032280
AA Change: F708L

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 476 513 2.96e-2 SMART
WD40 519 560 4.48e-2 SMART
WD40 565 604 2.84e-4 SMART
WD40 607 646 7.55e-9 SMART
WD40 649 687 3.07e1 SMART
WD40 689 728 4.18e-2 SMART
WD40 729 769 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178113
AA Change: F719L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136010
Gene: ENSMUSG00000032280
AA Change: F719L

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 6e-73 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 294 313 N/A INTRINSIC
WD40 487 524 2.96e-2 SMART
WD40 530 571 4.48e-2 SMART
WD40 576 615 2.84e-4 SMART
WD40 618 657 7.55e-9 SMART
WD40 660 698 3.07e1 SMART
WD40 700 739 4.18e-2 SMART
WD40 740 780 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162583
AA Change: F705L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124977
Gene: ENSMUSG00000032280
AA Change: F705L

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 473 510 2.96e-2 SMART
WD40 516 557 4.48e-2 SMART
WD40 562 601 2.84e-4 SMART
WD40 604 643 7.55e-9 SMART
WD40 646 684 3.07e1 SMART
WD40 686 725 4.18e-2 SMART
WD40 726 766 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162281
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-repressor protein that belongs to the transducin-like enhancer family of proteins. The members of this family function in the Notch signaling pathway that regulates determination of cell fate during development. Expression of this gene has been associated with a favorable outcome to chemotherapy with taxanes for ovarian carcinoma. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homzoygous for a gene trap allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,828 (GRCm39) R74W probably damaging Het
4933407L21Rik T G 1: 85,858,995 (GRCm39) probably null Het
Adcy8 A T 15: 64,792,320 (GRCm39) I212N possibly damaging Het
Cobll1 T C 2: 64,928,801 (GRCm39) T879A probably damaging Het
Copb2 T C 9: 98,456,164 (GRCm39) S233P probably damaging Het
Cpa5 T A 6: 30,630,436 (GRCm39) M330K probably damaging Het
Dgcr8 A T 16: 18,098,307 (GRCm39) N361K probably benign Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dock8 T A 19: 25,107,761 (GRCm39) N830K probably benign Het
Ephb1 C T 9: 102,072,633 (GRCm39) D49N probably benign Het
Fer1l6 A G 15: 58,443,238 (GRCm39) I514V probably benign Het
Fpr1 A G 17: 18,097,344 (GRCm39) I215T probably benign Het
Hectd4 G A 5: 121,491,565 (GRCm39) V3668M possibly damaging Het
Ighv3-4 T A 12: 114,217,388 (GRCm39) I68L probably benign Het
Intu A G 3: 40,647,402 (GRCm39) probably null Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Mycbp2 A C 14: 103,393,889 (GRCm39) S2781A possibly damaging Het
Myom2 T A 8: 15,172,705 (GRCm39) S1211T probably benign Het
Nrp1 A T 8: 129,194,929 (GRCm39) I462F probably benign Het
Or10d3 T C 9: 39,461,987 (GRCm39) Y60C probably damaging Het
Or6c5c T A 10: 129,299,307 (GRCm39) I254N probably damaging Het
Pcsk1 A C 13: 75,280,079 (GRCm39) S635R probably benign Het
Pms1 A T 1: 53,246,861 (GRCm39) Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Sema3b C A 9: 107,478,628 (GRCm39) A356S probably damaging Het
Shoc2 C A 19: 54,018,323 (GRCm39) T485K probably benign Het
Slc7a7 G A 14: 54,615,292 (GRCm39) S235L possibly damaging Het
Smcr8 A T 11: 60,674,977 (GRCm39) T918S probably benign Het
Tafa1 G A 6: 96,626,146 (GRCm39) R128Q probably damaging Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Other mutations in Tle3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Tle3 APN 9 61,316,039 (GRCm39) splice site probably benign
IGL00671:Tle3 APN 9 61,319,652 (GRCm39) missense probably damaging 1.00
IGL01583:Tle3 APN 9 61,317,307 (GRCm39) missense probably benign 0.00
IGL01684:Tle3 APN 9 61,310,728 (GRCm39) intron probably benign
IGL02109:Tle3 APN 9 61,320,332 (GRCm39) missense probably damaging 1.00
IGL02386:Tle3 APN 9 61,301,941 (GRCm39) missense possibly damaging 0.88
IGL02517:Tle3 APN 9 61,322,063 (GRCm39) missense probably damaging 1.00
IGL02930:Tle3 APN 9 61,301,981 (GRCm39) missense possibly damaging 0.52
IGL03103:Tle3 APN 9 61,300,524 (GRCm39) missense possibly damaging 0.46
R0391:Tle3 UTSW 9 61,323,943 (GRCm39) missense probably damaging 1.00
R0395:Tle3 UTSW 9 61,317,353 (GRCm39) missense probably damaging 0.99
R0621:Tle3 UTSW 9 61,317,387 (GRCm39) nonsense probably null
R1836:Tle3 UTSW 9 61,321,305 (GRCm39) missense probably damaging 1.00
R1921:Tle3 UTSW 9 61,318,622 (GRCm39) critical splice donor site probably null
R1978:Tle3 UTSW 9 61,301,915 (GRCm39) missense probably damaging 1.00
R3434:Tle3 UTSW 9 61,321,376 (GRCm39) splice site probably null
R4242:Tle3 UTSW 9 61,314,705 (GRCm39) missense probably benign
R4587:Tle3 UTSW 9 61,281,295 (GRCm39) missense probably damaging 0.99
R4811:Tle3 UTSW 9 61,281,279 (GRCm39) unclassified probably benign
R4877:Tle3 UTSW 9 61,280,781 (GRCm39) intron probably benign
R4913:Tle3 UTSW 9 61,281,275 (GRCm39) missense probably damaging 1.00
R5387:Tle3 UTSW 9 61,314,771 (GRCm39) splice site probably null
R5752:Tle3 UTSW 9 61,314,753 (GRCm39) missense probably damaging 1.00
R5917:Tle3 UTSW 9 61,316,190 (GRCm39) missense probably benign 0.19
R6000:Tle3 UTSW 9 61,281,296 (GRCm39) missense probably damaging 1.00
R6339:Tle3 UTSW 9 61,309,206 (GRCm39) splice site probably null
R7210:Tle3 UTSW 9 61,319,587 (GRCm39) missense probably damaging 1.00
R7460:Tle3 UTSW 9 61,320,366 (GRCm39) missense probably damaging 0.99
R7545:Tle3 UTSW 9 61,301,984 (GRCm39) missense possibly damaging 0.62
R7698:Tle3 UTSW 9 61,320,138 (GRCm39) missense probably damaging 1.00
R7916:Tle3 UTSW 9 61,314,410 (GRCm39) missense probably benign
R8075:Tle3 UTSW 9 61,281,841 (GRCm39) missense probably benign 0.05
R8941:Tle3 UTSW 9 61,320,195 (GRCm39) missense probably damaging 1.00
R9018:Tle3 UTSW 9 61,319,750 (GRCm39) missense probably damaging 1.00
R9060:Tle3 UTSW 9 61,282,821 (GRCm39) missense probably damaging 1.00
R9109:Tle3 UTSW 9 61,319,562 (GRCm39) missense possibly damaging 0.55
R9122:Tle3 UTSW 9 61,314,755 (GRCm39) unclassified probably benign
R9298:Tle3 UTSW 9 61,319,562 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GGACACTGAACTGTCTGTCC -3'
(R):5'- CAGGTCAACATGGAAAGCCTAC -3'

Sequencing Primer
(F):5'- ACTGAACTGTCTGTCCTTGCAG -3'
(R):5'- AGTGTCCTGGAGTGACATCCATATC -3'
Posted On 2016-11-21