Incidental Mutation 'R5745:Copb2'
ID 445756
Institutional Source Beutler Lab
Gene Symbol Copb2
Ensembl Gene ENSMUSG00000032458
Gene Name coatomer protein complex, subunit beta 2 (beta prime)
Synonyms
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 98563721-98588382 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98574111 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 233 (S233P)
Ref Sequence ENSEMBL: ENSMUSP00000035033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035033]
AlphaFold O55029
Predicted Effect probably damaging
Transcript: ENSMUST00000035033
AA Change: S233P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035033
Gene: ENSMUSG00000032458
AA Change: S233P

DomainStartEndE-ValueType
WD40 4 43 1.18e-1 SMART
WD40 46 85 3.9e-2 SMART
WD40 88 127 4.05e-9 SMART
WD40 131 171 1.51e-8 SMART
WD40 174 215 7.97e-8 SMART
WD40 218 257 5.9e-11 SMART
Pfam:Coatomer_WDAD 319 763 3.2e-176 PFAM
low complexity region 876 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214600
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi coatomer complex (see MIM 601924) constitutes the coat of nonclathrin-coated vesicles and is essential for Golgi budding and vesicular trafficking. It consists of 7 protein subunits, including COPB2.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Copb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Copb2 APN 9 98568077 missense probably benign 0.00
IGL00496:Copb2 APN 9 98570318 missense probably benign 0.00
IGL00518:Copb2 APN 9 98582894 missense possibly damaging 0.95
IGL00642:Copb2 APN 9 98579033 missense probably damaging 1.00
IGL00793:Copb2 APN 9 98585004 missense probably benign
IGL00806:Copb2 APN 9 98570664 missense probably damaging 0.97
IGL01599:Copb2 APN 9 98581150 missense probably damaging 0.98
IGL01906:Copb2 APN 9 98580330 missense probably benign 0.10
IGL02129:Copb2 APN 9 98585923 unclassified probably benign
IGL02138:Copb2 APN 9 98587552 missense probably benign
IGL03033:Copb2 APN 9 98570373 missense probably benign 0.10
R0646:Copb2 UTSW 9 98563475 unclassified probably benign
R0709:Copb2 UTSW 9 98563167 unclassified probably benign
R1631:Copb2 UTSW 9 98580160 missense probably benign 0.00
R2510:Copb2 UTSW 9 98571648 splice site probably benign
R4862:Copb2 UTSW 9 98581267 missense probably damaging 1.00
R5322:Copb2 UTSW 9 98585976 missense probably benign 0.03
R5593:Copb2 UTSW 9 98587038 critical splice acceptor site probably null
R5859:Copb2 UTSW 9 98568108 missense probably benign 0.17
R5990:Copb2 UTSW 9 98570325 missense probably damaging 1.00
R7109:Copb2 UTSW 9 98581280 critical splice donor site probably null
R7124:Copb2 UTSW 9 98577053 missense probably damaging 0.98
R7211:Copb2 UTSW 9 98574145 missense probably damaging 1.00
R7829:Copb2 UTSW 9 98588094 missense probably damaging 0.99
R7960:Copb2 UTSW 9 98580354 missense possibly damaging 0.65
R8311:Copb2 UTSW 9 98568019 missense possibly damaging 0.78
R8537:Copb2 UTSW 9 98587619 missense probably null 0.00
R8982:Copb2 UTSW 9 98574111 missense probably damaging 0.99
R9539:Copb2 UTSW 9 98585930 critical splice acceptor site probably null
R9762:Copb2 UTSW 9 98582848 missense probably benign 0.38
R9800:Copb2 UTSW 9 98579028 missense probably damaging 0.99
Z1176:Copb2 UTSW 9 98586146 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CAGTGAATGTTGTGATGTAACCGTG -3'
(R):5'- CTAGATTCCTAGTCATGATATGGAAGC -3'

Sequencing Primer
(F):5'- TGGTACACATTTCACCACATGC -3'
(R):5'- CCTAGTCATGATATGGAAGCTGCTAG -3'
Posted On 2016-11-21