Incidental Mutation 'R5745:Ephb1'
ID445757
Institutional Source Beutler Lab
Gene Symbol Ephb1
Ensembl Gene ENSMUSG00000032537
Gene NameEph receptor B1
SynonymsCek6, Net, C130099E04Rik, Hek6, Elk, Elkh
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location101922128-102354693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102195434 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 49 (D49N)
Ref Sequence ENSEMBL: ENSMUSP00000082261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169] [ENSMUST00000149800]
Predicted Effect probably benign
Transcript: ENSMUST00000035129
AA Change: D49N

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: D49N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
Pfam:EphA2_TM 542 616 3e-24 PFAM
TyrKc 619 878 6.45e-141 SMART
SAM 908 975 1.22e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085169
AA Change: D49N

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537
AA Change: D49N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
transmembrane domain 541 563 N/A INTRINSIC
TyrKc 585 837 2.35e-134 SMART
SAM 867 934 1.22e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149800
AA Change: D49N

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139470
Gene: ENSMUSG00000032537
AA Change: D49N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Ephb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Ephb1 APN 9 101996787 missense probably damaging 1.00
IGL01910:Ephb1 APN 9 102001857 missense probably benign 0.00
IGL02006:Ephb1 APN 9 102194772 critical splice donor site probably null
IGL02660:Ephb1 APN 9 102041092 missense possibly damaging 0.94
IGL02685:Ephb1 APN 9 102041103 nonsense probably null
IGL02802:Ephb1 UTSW 9 102010019 missense possibly damaging 0.87
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0180:Ephb1 UTSW 9 101927504 missense probably damaging 0.99
R0488:Ephb1 UTSW 9 101964008 missense probably damaging 1.00
R0511:Ephb1 UTSW 9 101995980 splice site probably benign
R0601:Ephb1 UTSW 9 102195130 missense probably damaging 1.00
R1622:Ephb1 UTSW 9 102001711 missense probably benign 0.00
R1643:Ephb1 UTSW 9 101996825 missense probably damaging 0.99
R1645:Ephb1 UTSW 9 101927559 missense probably damaging 1.00
R1914:Ephb1 UTSW 9 101929378 missense probably damaging 1.00
R1964:Ephb1 UTSW 9 101971123 missense possibly damaging 0.93
R2245:Ephb1 UTSW 9 101996774 splice site probably benign
R2247:Ephb1 UTSW 9 101996811 missense probably damaging 0.98
R2412:Ephb1 UTSW 9 102001816 missense possibly damaging 0.85
R3716:Ephb1 UTSW 9 102194800 missense probably damaging 1.00
R3756:Ephb1 UTSW 9 102041039 missense probably benign 0.01
R3797:Ephb1 UTSW 9 101971267 missense probably damaging 1.00
R3907:Ephb1 UTSW 9 102001726 missense probably benign 0.00
R4981:Ephb1 UTSW 9 102040960 missense probably benign
R5112:Ephb1 UTSW 9 101971179 missense probably damaging 1.00
R5507:Ephb1 UTSW 9 101936116 missense probably damaging 1.00
R6082:Ephb1 UTSW 9 101971104 missense probably damaging 1.00
R6183:Ephb1 UTSW 9 102195325 missense probably damaging 1.00
R6228:Ephb1 UTSW 9 101923584 missense probably damaging 1.00
R6572:Ephb1 UTSW 9 102066898 missense probably benign
R6596:Ephb1 UTSW 9 102194802 nonsense probably null
R6813:Ephb1 UTSW 9 102010048 missense possibly damaging 0.87
R6876:Ephb1 UTSW 9 101984120 missense probably damaging 1.00
R6922:Ephb1 UTSW 9 101929264 splice site probably null
R6950:Ephb1 UTSW 9 102194909 missense probably benign 0.03
R7144:Ephb1 UTSW 9 101964077 missense probably damaging 1.00
R7146:Ephb1 UTSW 9 101963958 missense probably damaging 1.00
R7328:Ephb1 UTSW 9 102195239 missense probably damaging 1.00
R7644:Ephb1 UTSW 9 101936194 missense probably damaging 1.00
R7737:Ephb1 UTSW 9 101984103 missense probably damaging 1.00
X0064:Ephb1 UTSW 9 101971272 missense probably damaging 1.00
Z1088:Ephb1 UTSW 9 101984145 missense probably damaging 0.99
Z1176:Ephb1 UTSW 9 102223398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTGGGACATTTGGAAG -3'
(R):5'- TGGTGCACGGTTGAGAACTG -3'

Sequencing Primer
(F):5'- ACATTTGGAAGGCTGCTGCAG -3'
(R):5'- TGCAGACATGGTTATACGAGCTC -3'
Posted On2016-11-21