Incidental Mutation 'R5745:Sema3b'
ID445758
Institutional Source Beutler Lab
Gene Symbol Sema3b
Ensembl Gene ENSMUSG00000057969
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
SynonymsSemA, sema5, semaV, Semaa, LUCA-1, SemA
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107597674-107609229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107601429 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 356 (A356S)
Ref Sequence ENSEMBL: ENSMUSP00000099591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073448] [ENSMUST00000102529] [ENSMUST00000102530] [ENSMUST00000102531] [ENSMUST00000102532] [ENSMUST00000123926] [ENSMUST00000193180] [ENSMUST00000194433] [ENSMUST00000194606] [ENSMUST00000195057] [ENSMUST00000195662]
Predicted Effect probably damaging
Transcript: ENSMUST00000073448
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073152
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102529
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099588
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102530
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099589
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102531
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099590
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102532
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099591
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123926
AA Change: A356S

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137952
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191791
Predicted Effect probably benign
Transcript: ENSMUST00000193180
SMART Domains Protein: ENSMUSP00000141726
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 148 8.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193551
Predicted Effect probably benign
Transcript: ENSMUST00000194433
SMART Domains Protein: ENSMUSP00000141403
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 172 3.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194606
Predicted Effect probably benign
Transcript: ENSMUST00000195057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195472
Predicted Effect probably benign
Transcript: ENSMUST00000195662
SMART Domains Protein: ENSMUSP00000141614
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 137 8.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that belongs to the class 3 semaphorin/collapsin family. Members of this family play a role in growth cone guidance during neurogenesis. The encoded protein inhibits axonal extension. This protein is thought to be an osteoblast protein that regulates bone mass and affects skeletal homeostasis. A similar gene in humans functions as a tumor suppressor gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile with no obvious pathological abnormalities. Mice homozygous for a second knock-out allele exhibit improper positioning of a major brain commissural projection, the anterior commissure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Sema3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Sema3b APN 9 107604041 critical splice donor site probably null
IGL02750:Sema3b APN 9 107603164 missense probably benign 0.02
IGL02878:Sema3b APN 9 107600993 missense probably damaging 0.97
IGL03004:Sema3b APN 9 107602915 missense possibly damaging 0.72
IGL03026:Sema3b APN 9 107602063 missense probably damaging 1.00
IGL03129:Sema3b APN 9 107599796 unclassified probably benign
IGL03334:Sema3b APN 9 107604077 missense probably damaging 1.00
R0373:Sema3b UTSW 9 107602918 missense probably benign 0.05
R0384:Sema3b UTSW 9 107600966 missense probably damaging 1.00
R0883:Sema3b UTSW 9 107604156 missense possibly damaging 0.77
R3916:Sema3b UTSW 9 107600458 missense probably damaging 1.00
R3971:Sema3b UTSW 9 107600368 missense probably benign
R4212:Sema3b UTSW 9 107603398 missense probably damaging 1.00
R4647:Sema3b UTSW 9 107599051 missense possibly damaging 0.79
R4694:Sema3b UTSW 9 107605002 missense probably benign 0.03
R4791:Sema3b UTSW 9 107603813 missense probably damaging 1.00
R4853:Sema3b UTSW 9 107602067 splice site probably null
R5305:Sema3b UTSW 9 107603337 missense probably null 1.00
R5487:Sema3b UTSW 9 107600962 missense probably damaging 1.00
R5751:Sema3b UTSW 9 107599714 missense probably benign
R6086:Sema3b UTSW 9 107600848 missense probably damaging 1.00
R6306:Sema3b UTSW 9 107600920 missense possibly damaging 0.88
R6594:Sema3b UTSW 9 107598826 missense probably benign 0.01
R6816:Sema3b UTSW 9 107600350 missense probably benign 0.08
R6833:Sema3b UTSW 9 107603316 missense probably benign 0.04
R7320:Sema3b UTSW 9 107600942 missense probably benign
R7448:Sema3b UTSW 9 107602963 missense probably damaging 1.00
R7687:Sema3b UTSW 9 107603814 missense probably damaging 1.00
Z1088:Sema3b UTSW 9 107599034 splice site probably null
Z1176:Sema3b UTSW 9 107599639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGACGGAATCACACTGCAC -3'
(R):5'- TCCCTGCAGAGGATGTTTTCC -3'

Sequencing Primer
(F):5'- GGAATCACACTGCACCCTCAC -3'
(R):5'- TCTGTCCTCCCGAGACCG -3'
Posted On2016-11-21