Incidental Mutation 'R5745:Sema3b'
ID 445758
Institutional Source Beutler Lab
Gene Symbol Sema3b
Ensembl Gene ENSMUSG00000057969
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
Synonyms semaV, Semaa, SemA, sema5, SemA, LUCA-1
MMRRC Submission 043198-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.341) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 107474873-107486428 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 107478628 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 356 (A356S)
Ref Sequence ENSEMBL: ENSMUSP00000099591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073448] [ENSMUST00000102529] [ENSMUST00000102530] [ENSMUST00000102531] [ENSMUST00000102532] [ENSMUST00000123926] [ENSMUST00000194606] [ENSMUST00000194433] [ENSMUST00000193180] [ENSMUST00000195057] [ENSMUST00000195662]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000073448
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073152
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102529
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099588
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102530
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099589
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102531
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099590
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102532
AA Change: A356S

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099591
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123926
AA Change: A356S

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137952
Gene: ENSMUSG00000057969
AA Change: A356S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195472
Predicted Effect probably benign
Transcript: ENSMUST00000194606
Predicted Effect probably benign
Transcript: ENSMUST00000194433
SMART Domains Protein: ENSMUSP00000141403
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 172 3.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193180
SMART Domains Protein: ENSMUSP00000141726
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 148 8.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195057
Predicted Effect probably benign
Transcript: ENSMUST00000195662
SMART Domains Protein: ENSMUSP00000141614
Gene: ENSMUSG00000057969

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 137 8.4e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that belongs to the class 3 semaphorin/collapsin family. Members of this family play a role in growth cone guidance during neurogenesis. The encoded protein inhibits axonal extension. This protein is thought to be an osteoblast protein that regulates bone mass and affects skeletal homeostasis. A similar gene in humans functions as a tumor suppressor gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile with no obvious pathological abnormalities. Mice homozygous for a second knock-out allele exhibit improper positioning of a major brain commissural projection, the anterior commissure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,828 (GRCm39) R74W probably damaging Het
4933407L21Rik T G 1: 85,858,995 (GRCm39) probably null Het
Adcy8 A T 15: 64,792,320 (GRCm39) I212N possibly damaging Het
Cobll1 T C 2: 64,928,801 (GRCm39) T879A probably damaging Het
Copb2 T C 9: 98,456,164 (GRCm39) S233P probably damaging Het
Cpa5 T A 6: 30,630,436 (GRCm39) M330K probably damaging Het
Dgcr8 A T 16: 18,098,307 (GRCm39) N361K probably benign Het
Dmxl1 A G 18: 49,979,653 (GRCm39) E96G probably benign Het
Dock8 T A 19: 25,107,761 (GRCm39) N830K probably benign Het
Ephb1 C T 9: 102,072,633 (GRCm39) D49N probably benign Het
Fer1l6 A G 15: 58,443,238 (GRCm39) I514V probably benign Het
Fpr1 A G 17: 18,097,344 (GRCm39) I215T probably benign Het
Hectd4 G A 5: 121,491,565 (GRCm39) V3668M possibly damaging Het
Ighv3-4 T A 12: 114,217,388 (GRCm39) I68L probably benign Het
Intu A G 3: 40,647,402 (GRCm39) probably null Het
Kel C T 6: 41,675,961 (GRCm39) G243E probably damaging Het
Mycbp2 A C 14: 103,393,889 (GRCm39) S2781A possibly damaging Het
Myom2 T A 8: 15,172,705 (GRCm39) S1211T probably benign Het
Nrp1 A T 8: 129,194,929 (GRCm39) I462F probably benign Het
Or10d3 T C 9: 39,461,987 (GRCm39) Y60C probably damaging Het
Or6c5c T A 10: 129,299,307 (GRCm39) I254N probably damaging Het
Pcsk1 A C 13: 75,280,079 (GRCm39) S635R probably benign Het
Pms1 A T 1: 53,246,861 (GRCm39) Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,127 (GRCm39) probably benign Het
Shoc2 C A 19: 54,018,323 (GRCm39) T485K probably benign Het
Slc7a7 G A 14: 54,615,292 (GRCm39) S235L possibly damaging Het
Smcr8 A T 11: 60,674,977 (GRCm39) T918S probably benign Het
Tafa1 G A 6: 96,626,146 (GRCm39) R128Q probably damaging Het
Tle3 C A 9: 61,322,133 (GRCm39) F719L probably damaging Het
Vmn2r45 T A 7: 8,486,074 (GRCm39) I405L probably benign Het
Vmn2r57 A T 7: 41,097,895 (GRCm39) H57Q possibly damaging Het
Other mutations in Sema3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Sema3b APN 9 107,481,240 (GRCm39) critical splice donor site probably null
IGL02750:Sema3b APN 9 107,480,363 (GRCm39) missense probably benign 0.02
IGL02878:Sema3b APN 9 107,478,192 (GRCm39) missense probably damaging 0.97
IGL03004:Sema3b APN 9 107,480,114 (GRCm39) missense possibly damaging 0.72
IGL03026:Sema3b APN 9 107,479,262 (GRCm39) missense probably damaging 1.00
IGL03129:Sema3b APN 9 107,476,995 (GRCm39) unclassified probably benign
IGL03334:Sema3b APN 9 107,481,276 (GRCm39) missense probably damaging 1.00
R0373:Sema3b UTSW 9 107,480,117 (GRCm39) missense probably benign 0.05
R0384:Sema3b UTSW 9 107,478,165 (GRCm39) missense probably damaging 1.00
R0883:Sema3b UTSW 9 107,481,355 (GRCm39) missense possibly damaging 0.77
R3916:Sema3b UTSW 9 107,477,657 (GRCm39) missense probably damaging 1.00
R3971:Sema3b UTSW 9 107,477,567 (GRCm39) missense probably benign
R4212:Sema3b UTSW 9 107,480,597 (GRCm39) missense probably damaging 1.00
R4647:Sema3b UTSW 9 107,476,250 (GRCm39) missense possibly damaging 0.79
R4694:Sema3b UTSW 9 107,482,201 (GRCm39) missense probably benign 0.03
R4791:Sema3b UTSW 9 107,481,012 (GRCm39) missense probably damaging 1.00
R4853:Sema3b UTSW 9 107,479,266 (GRCm39) splice site probably null
R5305:Sema3b UTSW 9 107,480,536 (GRCm39) missense probably null 1.00
R5487:Sema3b UTSW 9 107,478,161 (GRCm39) missense probably damaging 1.00
R5751:Sema3b UTSW 9 107,476,913 (GRCm39) missense probably benign
R6086:Sema3b UTSW 9 107,478,047 (GRCm39) missense probably damaging 1.00
R6306:Sema3b UTSW 9 107,478,119 (GRCm39) missense possibly damaging 0.88
R6594:Sema3b UTSW 9 107,476,025 (GRCm39) missense probably benign 0.01
R6816:Sema3b UTSW 9 107,477,549 (GRCm39) missense probably benign 0.08
R6833:Sema3b UTSW 9 107,480,515 (GRCm39) missense probably benign 0.04
R7320:Sema3b UTSW 9 107,478,141 (GRCm39) missense probably benign
R7448:Sema3b UTSW 9 107,480,162 (GRCm39) missense probably damaging 1.00
R7687:Sema3b UTSW 9 107,481,013 (GRCm39) missense probably damaging 1.00
R8839:Sema3b UTSW 9 107,478,552 (GRCm39) unclassified probably benign
R9090:Sema3b UTSW 9 107,476,154 (GRCm39) missense probably damaging 1.00
R9123:Sema3b UTSW 9 107,478,173 (GRCm39) missense possibly damaging 0.64
R9271:Sema3b UTSW 9 107,476,154 (GRCm39) missense probably damaging 1.00
R9442:Sema3b UTSW 9 107,478,957 (GRCm39) critical splice donor site probably null
R9682:Sema3b UTSW 9 107,481,013 (GRCm39) missense probably damaging 1.00
R9755:Sema3b UTSW 9 107,478,784 (GRCm39) missense probably damaging 1.00
Z1088:Sema3b UTSW 9 107,476,233 (GRCm39) splice site probably null
Z1176:Sema3b UTSW 9 107,476,838 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGGACGGAATCACACTGCAC -3'
(R):5'- TCCCTGCAGAGGATGTTTTCC -3'

Sequencing Primer
(F):5'- GGAATCACACTGCACCCTCAC -3'
(R):5'- TCTGTCCTCCCGAGACCG -3'
Posted On 2016-11-21