Incidental Mutation 'R5745:Ighv3-4'
ID445762
Institutional Source Beutler Lab
Gene Symbol Ighv3-4
Ensembl Gene ENSMUSG00000103939
Gene Nameimmunoglobulin heavy variable V3-4
Synonyms
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location114253617-114254051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114253768 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 68 (I68L)
Ref Sequence ENSEMBL: ENSMUSP00000141962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000193408]
Predicted Effect probably benign
Transcript: ENSMUST00000193408
AA Change: I68L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000141962
Gene: ENSMUSG00000103939
AA Change: I68L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGv 35 117 1.2e-29 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Ighv3-4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3907:Ighv3-4 UTSW 12 114253918 missense probably damaging 1.00
R3957:Ighv3-4 UTSW 12 114253680 missense probably damaging 1.00
R4237:Ighv3-4 UTSW 12 114253913 missense probably benign 0.00
R4238:Ighv3-4 UTSW 12 114253913 missense probably benign 0.00
R4239:Ighv3-4 UTSW 12 114253913 missense probably benign 0.00
R4355:Ighv3-4 UTSW 12 114253640 missense probably benign 0.01
R5026:Ighv3-4 UTSW 12 114253762 missense probably benign 0.03
R7068:Ighv3-4 UTSW 12 114253654 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGTCTGGGCTCACACTGG -3'
(R):5'- TGTTGCCACTTTATACATGTGC -3'

Sequencing Primer
(F):5'- CACTGGAGACTCAATACTGTGTC -3'
(R):5'- GAGCTTGACAGAAATGACTCTTC -3'
Posted On2016-11-21