Incidental Mutation 'R5745:Slc7a7'
ID445764
Institutional Source Beutler Lab
Gene Symbol Slc7a7
Ensembl Gene ENSMUSG00000000958
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonymsmy+lat1
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54369442-54417780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54377835 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 235 (S235L)
Ref Sequence ENSEMBL: ENSMUSP00000154533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000984] [ENSMUST00000195970] [ENSMUST00000197440] [ENSMUST00000200545] [ENSMUST00000226753] [ENSMUST00000228488]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000984
AA Change: S235L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000984
Gene: ENSMUSG00000000958
AA Change: S235L

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000195970
AA Change: S235L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143091
Gene: ENSMUSG00000000958
AA Change: S235L

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 462 6.4e-66 PFAM
Pfam:AA_permease 43 467 5.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196966
Predicted Effect possibly damaging
Transcript: ENSMUST00000197440
AA Change: S235L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143743
Gene: ENSMUSG00000000958
AA Change: S235L

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 463 2e-64 PFAM
Pfam:AA_permease 43 463 6.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197667
Predicted Effect probably benign
Transcript: ENSMUST00000200545
SMART Domains Protein: ENSMUSP00000142587
Gene: ENSMUSG00000000958

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 36 183 7.5e-5 PFAM
Pfam:AA_permease_2 38 186 4.3e-19 PFAM
Pfam:AA_permease 43 185 2.4e-6 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226753
AA Change: S235L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000228488
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the light subunit of a cationic amino acid transporter. This sodium-independent transporter is formed when the light subunit encoded by this gene dimerizes with the heavy subunit transporter protein SLC3A2. This transporter is found in epithelial cell membranes where it transfers cationic and large neutral amino acids from the cell to the extracellular space. Defects in this gene are a cause of lysinuric protein intolerance (LPI). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice exhibit fetal growth retardation and often die neonatally. After heavy protein ingestion, surviving adults show a metabolic derangement akin to lysinuric protein intolerance and including a lasting postnatal growth retardation, splenomegaly, hyperammonemia, and aminoaciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Slc7a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R0331:Slc7a7 UTSW 14 54377924 unclassified probably benign
R0608:Slc7a7 UTSW 14 54377802 missense probably damaging 1.00
R1311:Slc7a7 UTSW 14 54373030 nonsense probably null
R1489:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R1490:Slc7a7 UTSW 14 54408646 missense probably damaging 1.00
R4049:Slc7a7 UTSW 14 54373091 critical splice acceptor site probably null
R4731:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4732:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R4733:Slc7a7 UTSW 14 54408733 missense probably damaging 1.00
R5562:Slc7a7 UTSW 14 54408812 missense probably benign
R5907:Slc7a7 UTSW 14 54379103 missense probably damaging 1.00
R6140:Slc7a7 UTSW 14 54379058 missense probably damaging 1.00
R6366:Slc7a7 UTSW 14 54374600 missense probably damaging 1.00
R6696:Slc7a7 UTSW 14 54377761 splice site probably null
R6776:Slc7a7 UTSW 14 54374651 missense possibly damaging 0.95
R7310:Slc7a7 UTSW 14 54379025 missense probably damaging 0.99
R7399:Slc7a7 UTSW 14 54374268 missense possibly damaging 0.87
R7903:Slc7a7 UTSW 14 54373909 missense probably damaging 1.00
R7986:Slc7a7 UTSW 14 54373909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACTACATACAGCCATGG -3'
(R):5'- GAACACCACCTGTTTCTAGCC -3'

Sequencing Primer
(F):5'- GCCATGGACAAGTTATATCTCTAGG -3'
(R):5'- ACCTGTTTCTAGCCCTGCTGG -3'
Posted On2016-11-21