Incidental Mutation 'R5745:Dgcr8'
ID445768
Institutional Source Beutler Lab
Gene Symbol Dgcr8
Ensembl Gene ENSMUSG00000022718
Gene NameDGCR8, microprocessor complex subunit
SynonymsGy1, D16H22S788E, D16Wis2, D16H22S1742E, Vo59c07, N41
MMRRC Submission 043198-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5745 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location18253948-18289246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18280443 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 361 (N361K)
Ref Sequence ENSEMBL: ENSMUSP00000009321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000115633] [ENSMUST00000232424]
Predicted Effect probably benign
Transcript: ENSMUST00000009321
AA Change: N361K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718
AA Change: N361K

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115633
SMART Domains Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

DomainStartEndE-ValueType
low complexity region 165 176 N/A INTRINSIC
WW 302 334 7.26e-6 SMART
low complexity region 411 421 N/A INTRINSIC
DSRM 512 577 5.68e-10 SMART
DSRM 620 685 8.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232414
Predicted Effect probably benign
Transcript: ENSMUST00000232424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232476
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the microprocessor complex which mediates the biogenesis of microRNAs from the primary microRNA transcript. The encoded protein is a double-stranded RNA binding protein that functions as the non-catalytic subunit of the microprocessor complex. This protein is required for binding the double-stranded RNA substrate and facilitates cleavage of the RNA by the ribonuclease III protein, Drosha. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit reduced dendritic spine number and dendritiic complexity along with abnormal prepulse inhibition and abnormal spatial working memory. Homozygous mice are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Fpr1 A G 17: 17,877,082 I215T probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Dgcr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Dgcr8 APN 16 18283944 missense probably damaging 1.00
IGL01767:Dgcr8 APN 16 18278336 missense probably damaging 0.98
IGL02349:Dgcr8 APN 16 18280306 missense possibly damaging 0.67
IGL02834:Dgcr8 APN 16 18272759 missense probably benign 0.08
R1558:Dgcr8 UTSW 16 18259588 missense probably damaging 1.00
R1587:Dgcr8 UTSW 16 18280291 missense probably damaging 1.00
R1656:Dgcr8 UTSW 16 18256713 missense probably benign 0.00
R1866:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R1886:Dgcr8 UTSW 16 18278354 missense possibly damaging 0.95
R2144:Dgcr8 UTSW 16 18284256 missense probably damaging 1.00
R2145:Dgcr8 UTSW 16 18280230 missense probably benign 0.26
R3773:Dgcr8 UTSW 16 18256775 missense probably damaging 0.99
R4568:Dgcr8 UTSW 16 18280394 missense probably benign 0.14
R4783:Dgcr8 UTSW 16 18258310 nonsense probably null
R4784:Dgcr8 UTSW 16 18258310 nonsense probably null
R5138:Dgcr8 UTSW 16 18278077 missense probably damaging 0.99
R5276:Dgcr8 UTSW 16 18283771 missense probably benign 0.01
R5476:Dgcr8 UTSW 16 18259979 missense probably damaging 1.00
R5510:Dgcr8 UTSW 16 18277175 missense probably damaging 0.98
R5771:Dgcr8 UTSW 16 18272768 missense probably benign 0.25
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6035:Dgcr8 UTSW 16 18258314 missense probably damaging 1.00
R6182:Dgcr8 UTSW 16 18280308 missense probably benign 0.00
R6190:Dgcr8 UTSW 16 18284410 missense probably damaging 0.97
R6633:Dgcr8 UTSW 16 18284182 missense possibly damaging 0.94
R6786:Dgcr8 UTSW 16 18283829 nonsense probably null
R7468:Dgcr8 UTSW 16 18259623 missense probably damaging 1.00
Z1176:Dgcr8 UTSW 16 18278318
Predicted Primers PCR Primer
(F):5'- TGCACACCTCAACTTTAGCC -3'
(R):5'- CCCTACTTCTTGGGAACAGG -3'

Sequencing Primer
(F):5'- AGCCTTCACTTGTCCCAGGG -3'
(R):5'- TCTTGGGAACAGGAAGCATAC -3'
Posted On2016-11-21