Mutagenetix > Incidental Mutations

Incidental Mutation 'R5745:Dgcr8'

445768

Institutional Source

Beutler Lab

Gene Symbol

Dgcr8

Ensembl Gene

ENSMUSG00000022718

Gene Name

DGCR8, microprocessor complex subunit

Synonyms

Gy1, D16H22S788E, D16Wis2, D16H22S1742E, Vo59c07, N41

MMRRC Submission

043198-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5745 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18253948-18289246 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 18280443 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 361 (N361K)

Ref Sequence

ENSEMBL: ENSMUSP00000009321 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009321] [ENSMUST00000115633] [ENSMUST00000232424]

Predicted Effect

probably benign
Transcript: ENSMUST00000009321
AA Change: N361K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000009321
Gene: ENSMUSG00000022718
AA Change: N361K

Domain	Start	End	E-Value	Type
low complexity region	165	176	N/A	INTRINSIC
WW	302	334	7.26e-6	SMART
low complexity region	411	421	N/A	INTRINSIC
DSRM	512	577	5.68e-10	SMART
DSRM	620	685	8.26e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115633

SMART Domains

Protein: ENSMUSP00000111296
Gene: ENSMUSG00000022718

Domain	Start	End	E-Value	Type
low complexity region	165	176	N/A	INTRINSIC
WW	302	334	7.26e-6	SMART
low complexity region	411	421	N/A	INTRINSIC
DSRM	512	577	5.68e-10	SMART
DSRM	620	685	8.26e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000116802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128856

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175505

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232414

Predicted Effect

probably benign
Transcript: ENSMUST00000232424

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232476

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the microprocessor complex which mediates the biogenesis of microRNAs from the primary microRNA transcript. The encoded protein is a double-stranded RNA binding protein that functions as the non-catalytic subunit of the microprocessor complex. This protein is required for binding the double-stranded RNA substrate and facilitates cleavage of the RNA by the ribonuclease III protein, Drosha. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice heterozygous for a gene trap allele exhibit reduced dendritic spine number and dendritiic complexity along with abnormal prepulse inhibition and abnormal spatial working memory. Homozygous mice are embryonic lethal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110082I17Rik	G	A	5: 139,364,073	R74W	probably damaging	Het
4933407L21Rik	T	G	1: 85,931,274		probably null	Het
Adcy8	A	T	15: 64,920,471	I212N	possibly damaging	Het
Cobll1	T	C	2: 65,098,457	T879A	probably damaging	Het
Copb2	T	C	9: 98,574,111	S233P	probably damaging	Het
Cpa5	T	A	6: 30,630,437	M330K	probably damaging	Het
Dmxl1	A	G	18: 49,846,586	E96G	probably benign	Het
Dock8	T	A	19: 25,130,397	N830K	probably benign	Het
Ephb1	C	T	9: 102,195,434	D49N	probably benign	Het
Fam19a1	G	A	6: 96,649,185	R128Q	probably damaging	Het
Fer1l6	A	G	15: 58,571,389	I514V	probably benign	Het
Fpr1	A	G	17: 17,877,082	I215T	probably benign	Het
Hectd4	G	A	5: 121,353,502	V3668M	possibly damaging	Het
Ighv3-4	T	A	12: 114,253,768	I68L	probably benign	Het
Intu	A	G	3: 40,692,972		probably null	Het
Kel	C	T	6: 41,699,027	G243E	probably damaging	Het
Mycbp2	A	C	14: 103,156,453	S2781A	possibly damaging	Het
Myom2	T	A	8: 15,122,705	S1211T	probably benign	Het
Nrp1	A	T	8: 128,468,448	I462F	probably benign	Het
Olfr787	T	A	10: 129,463,438	I254N	probably damaging	Het
Olfr958	T	C	9: 39,550,691	Y60C	probably damaging	Het
Pcsk1	A	C	13: 75,131,960	S635R	probably benign	Het
Pms1	A	T	1: 53,207,702	Y280*	probably null	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,920		probably benign	Het
Sema3b	C	A	9: 107,601,429	A356S	probably damaging	Het
Shoc2	C	A	19: 54,029,892	T485K	probably benign	Het
Slc7a7	G	A	14: 54,377,835	S235L	possibly damaging	Het
Smcr8	A	T	11: 60,784,151	T918S	probably benign	Het
Tle3	C	A	9: 61,414,851	F719L	probably damaging	Het
Vmn2r45	T	A	7: 8,483,075	I405L	probably benign	Het
Vmn2r57	A	T	7: 41,448,471	H57Q	possibly damaging	Het

Other mutations in Dgcr8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Dgcr8	APN	16	18283944	missense	probably damaging	1.00
IGL01767:Dgcr8	APN	16	18278336	missense	probably damaging	0.98
IGL02349:Dgcr8	APN	16	18280306	missense	possibly damaging	0.67
IGL02834:Dgcr8	APN	16	18272759	missense	probably benign	0.08
R1558:Dgcr8	UTSW	16	18259588	missense	probably damaging	1.00
R1587:Dgcr8	UTSW	16	18280291	missense	probably damaging	1.00
R1656:Dgcr8	UTSW	16	18256713	missense	probably benign	0.00
R1866:Dgcr8	UTSW	16	18258314	missense	probably damaging	1.00
R1886:Dgcr8	UTSW	16	18278354	missense	possibly damaging	0.95
R2144:Dgcr8	UTSW	16	18284256	missense	probably damaging	1.00
R2145:Dgcr8	UTSW	16	18280230	missense	probably benign	0.26
R3773:Dgcr8	UTSW	16	18256775	missense	probably damaging	0.99
R4568:Dgcr8	UTSW	16	18280394	missense	probably benign	0.14
R4783:Dgcr8	UTSW	16	18258310	nonsense	probably null
R4784:Dgcr8	UTSW	16	18258310	nonsense	probably null
R5138:Dgcr8	UTSW	16	18278077	missense	probably damaging	0.99
R5276:Dgcr8	UTSW	16	18283771	missense	probably benign	0.01
R5476:Dgcr8	UTSW	16	18259979	missense	probably damaging	1.00
R5510:Dgcr8	UTSW	16	18277175	missense	probably damaging	0.98
R5771:Dgcr8	UTSW	16	18272768	missense	probably benign	0.25
R6035:Dgcr8	UTSW	16	18258314	missense	probably damaging	1.00
R6035:Dgcr8	UTSW	16	18258314	missense	probably damaging	1.00
R6182:Dgcr8	UTSW	16	18280308	missense	probably benign	0.00
R6190:Dgcr8	UTSW	16	18284410	missense	probably damaging	0.97
R6633:Dgcr8	UTSW	16	18284182	missense	possibly damaging	0.94
R6786:Dgcr8	UTSW	16	18283829	nonsense	probably null
R7468:Dgcr8	UTSW	16	18259623	missense	probably damaging	1.00
Z1176:Dgcr8	UTSW	16	18278318

Predicted Primers

PCR Primer
(F):5'- TGCACACCTCAACTTTAGCC -3'
(R):5'- CCCTACTTCTTGGGAACAGG -3'

Sequencing Primer
(F):5'- AGCCTTCACTTGTCCCAGGG -3'
(R):5'- TCTTGGGAACAGGAAGCATAC -3'

Posted On

2016-11-21