Incidental Mutation 'R5745:Fpr1'
ID 445769
Institutional Source Beutler Lab
Gene Symbol Fpr1
Ensembl Gene ENSMUSG00000045551
Gene Name formyl peptide receptor 1
Synonyms fMLF-R, FPR
MMRRC Submission 043198-MU
Accession Numbers

Genbank: NM_013521
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5745 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 17876471-17883940 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17877082 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 215 (I215T)
Ref Sequence ENSEMBL: ENSMUSP00000052894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061516]
AlphaFold P33766
Predicted Effect probably benign
Transcript: ENSMUST00000061516
AA Change: I215T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052894
Gene: ENSMUSG00000045551
AA Change: I215T

DomainStartEndE-ValueType
Pfam:7tm_1 51 312 8.2e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor of mammalian phagocytic cells that is a member of the G-protein coupled receptor 1 family. The protein mediates the response of phagocytic cells to invasion of the host by microorganisms and is important in host defense and inflammation.[provided by RefSeq, Jul 2010]
PHENOTYPE: Targeted null mice are viable and developmentally normal but show increased susceptibility to L. monocytogenes challenge, as shown by increased mortality and bacterial burden in liver/spleen early post-infection. Mutant neutrophils fail to respond to fMLF either in calcium flux or chemotaxis assays. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,073 R74W probably damaging Het
4933407L21Rik T G 1: 85,931,274 probably null Het
Adcy8 A T 15: 64,920,471 I212N possibly damaging Het
Cobll1 T C 2: 65,098,457 T879A probably damaging Het
Copb2 T C 9: 98,574,111 S233P probably damaging Het
Cpa5 T A 6: 30,630,437 M330K probably damaging Het
Dgcr8 A T 16: 18,280,443 N361K probably benign Het
Dmxl1 A G 18: 49,846,586 E96G probably benign Het
Dock8 T A 19: 25,130,397 N830K probably benign Het
Ephb1 C T 9: 102,195,434 D49N probably benign Het
Fam19a1 G A 6: 96,649,185 R128Q probably damaging Het
Fer1l6 A G 15: 58,571,389 I514V probably benign Het
Hectd4 G A 5: 121,353,502 V3668M possibly damaging Het
Ighv3-4 T A 12: 114,253,768 I68L probably benign Het
Intu A G 3: 40,692,972 probably null Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Mycbp2 A C 14: 103,156,453 S2781A possibly damaging Het
Myom2 T A 8: 15,122,705 S1211T probably benign Het
Nrp1 A T 8: 128,468,448 I462F probably benign Het
Olfr787 T A 10: 129,463,438 I254N probably damaging Het
Olfr958 T C 9: 39,550,691 Y60C probably damaging Het
Pcsk1 A C 13: 75,131,960 S635R probably benign Het
Pms1 A T 1: 53,207,702 Y280* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,920 probably benign Het
Sema3b C A 9: 107,601,429 A356S probably damaging Het
Shoc2 C A 19: 54,029,892 T485K probably benign Het
Slc7a7 G A 14: 54,377,835 S235L possibly damaging Het
Smcr8 A T 11: 60,784,151 T918S probably benign Het
Tle3 C A 9: 61,414,851 F719L probably damaging Het
Vmn2r45 T A 7: 8,483,075 I405L probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Other mutations in Fpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Fpr1 APN 17 17877001 missense probably benign 0.00
IGL01473:Fpr1 APN 17 17877692 missense possibly damaging 0.95
IGL01704:Fpr1 APN 17 17876972 missense possibly damaging 0.64
IGL01900:Fpr1 APN 17 17877521 missense probably damaging 0.96
IGL02548:Fpr1 APN 17 17876653 missense probably benign 0.01
G5030:Fpr1 UTSW 17 17876806 missense probably damaging 1.00
PIT4445001:Fpr1 UTSW 17 17876893 missense probably benign
R0284:Fpr1 UTSW 17 17877356 missense probably damaging 0.99
R1440:Fpr1 UTSW 17 17877263 missense probably benign 0.01
R1631:Fpr1 UTSW 17 17877001 missense probably benign 0.00
R1823:Fpr1 UTSW 17 17877053 missense probably benign 0.00
R1994:Fpr1 UTSW 17 17877617 missense probably benign 0.01
R2168:Fpr1 UTSW 17 17877209 missense possibly damaging 0.52
R2364:Fpr1 UTSW 17 17877610 nonsense probably null
R3110:Fpr1 UTSW 17 17876635 missense probably benign 0.01
R3111:Fpr1 UTSW 17 17876635 missense probably benign 0.01
R3112:Fpr1 UTSW 17 17876635 missense probably benign 0.01
R3440:Fpr1 UTSW 17 17877158 missense probably benign
R3949:Fpr1 UTSW 17 17876929 missense probably benign
R5750:Fpr1 UTSW 17 17877263 missense probably benign 0.01
R6130:Fpr1 UTSW 17 17877635 missense probably benign 0.13
R6187:Fpr1 UTSW 17 17876928 nonsense probably null
R7017:Fpr1 UTSW 17 17877392 missense probably benign 0.00
R7358:Fpr1 UTSW 17 17876980 missense probably damaging 0.99
R7840:Fpr1 UTSW 17 17877372 missense probably benign 0.15
R8762:Fpr1 UTSW 17 17877589 missense probably damaging 1.00
R9033:Fpr1 UTSW 17 17877429 nonsense probably null
R9080:Fpr1 UTSW 17 17876950 missense probably benign 0.02
R9144:Fpr1 UTSW 17 17877364 missense probably damaging 1.00
R9260:Fpr1 UTSW 17 17877744 splice site probably benign
R9655:Fpr1 UTSW 17 17877356 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGTCATGTTCTTCAACCGTTC -3'
(R):5'- CATCGTACCCTGGATTTGTGC -3'

Sequencing Primer
(F):5'- GGATATGAGGGCCACTACTTG -3'
(R):5'- GTACCCTGGATTTGTGCATTTC -3'
Posted On 2016-11-21