Mutagenetix > Incidental Mutation

Incidental Mutation 'R5746:Stx16'

445775

Institutional Source

Beutler Lab

Gene Symbol

Stx16

Ensembl Gene

ENSMUSG00000027522

Gene Name

syntaxin 16

Synonyms

5430410K23Rik, 6330500A18Rik, SYN16

MMRRC Submission

043199-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5746 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

173918101-173941564 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 173935292 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 156 (G156R)

Ref Sequence

ENSEMBL: ENSMUSP00000120279 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044638] [ENSMUST00000087908] [ENSMUST00000134876] [ENSMUST00000147038] [ENSMUST00000155000]

AlphaFold

Q8BVI5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044638
AA Change: G210R

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039543
Gene: ENSMUSG00000027522
AA Change: G210R

Domain	Start	End	E-Value	Type
Blast:SynN	76	190	2e-20	BLAST
t_SNARE	227	294	9.13e-23	SMART
transmembrane domain	305	324	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087908
AA Change: G209R

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000085218
Gene: ENSMUSG00000027522
AA Change: G209R

Domain	Start	End	E-Value	Type
Pfam:Syntaxin	74	174	2.1e-15	PFAM
t_SNARE	226	293	9.13e-23	SMART
transmembrane domain	304	323	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134876

Predicted Effect

probably damaging
Transcript: ENSMUST00000147038
AA Change: G156R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000120279
Gene: ENSMUSG00000027522
AA Change: G156R

Domain	Start	End	E-Value	Type
Pfam:Syntaxin	21	121	3e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155000

SMART Domains

Protein: ENSMUSP00000119952
Gene: ENSMUSG00000027522

Domain	Start	End	E-Value	Type
Pfam:Syntaxin	21	89	4.8e-13	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000156054
AA Change: G206R

SMART Domains

Protein: ENSMUSP00000116618
Gene: ENSMUSG00000027522
AA Change: G206R

Domain	Start	End	E-Value	Type
Blast:SynN	73	187	5e-21	BLAST
Pfam:SNARE	217	258	6.6e-18	PFAM

Meta Mutation Damage Score

0.2687

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and do not exhibit methylation abnormalities or develop a pseudohypoparathyroidism resistance phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adora3	A	G	3: 105,815,126 (GRCm39)	E292G	possibly damaging	Het
Ank1	C	T	8: 23,606,612 (GRCm39)	T1187I	probably damaging	Het
Ankrd16	T	A	2: 11,789,178 (GRCm39)	I255K	probably damaging	Het
Atp6ap1l	T	C	13: 91,031,698 (GRCm39)	N328S	probably benign	Het
Cbln3	A	G	14: 56,120,601 (GRCm39)	S144P	probably damaging	Het
Cdh12	T	A	15: 21,358,810 (GRCm39)	L78Q	probably null	Het
Cpsf1	C	T	15: 76,484,037 (GRCm39)	R761H	probably benign	Het
Cyp2d10	T	G	15: 82,289,472 (GRCm39)	E213D	probably benign	Het
Gba2	T	C	4: 43,568,465 (GRCm39)		probably null	Het
Glb1l2	G	A	9: 26,708,086 (GRCm39)	A29V	probably benign	Het
Gm11149	C	T	9: 49,457,494 (GRCm39)	G393S	probably damaging	Het
Igkv6-29	C	A	6: 70,115,584 (GRCm39)	G70V	possibly damaging	Het
Kcnma1	T	C	14: 23,544,635 (GRCm39)	N574S	probably damaging	Het
Kdm2b	A	G	5: 123,017,427 (GRCm39)	V1099A	probably damaging	Het
Kel	C	T	6: 41,675,961 (GRCm39)	G243E	probably damaging	Het
Ly6g	A	T	15: 75,028,596 (GRCm39)	N19Y	possibly damaging	Het
Nexn	TCTTCCTTC	TCTTC	3: 151,948,513 (GRCm39)		probably benign	Het
Nod2	T	C	8: 89,390,970 (GRCm39)	S411P	probably damaging	Het
Plekha6	G	C	1: 133,200,045 (GRCm39)	R208P	possibly damaging	Het
Ptpn14	G	A	1: 189,578,610 (GRCm39)		probably null	Het
Smg6	G	A	11: 75,030,113 (GRCm39)	G211E	probably damaging	Het
Tbc1d15	T	C	10: 115,046,184 (GRCm39)	S440G	probably damaging	Het
Tpm2	A	G	4: 43,519,731 (GRCm39)	V85A	possibly damaging	Het
Ttf1	G	T	2: 28,955,754 (GRCm39)	A373S	probably damaging	Het
Vmn2r11	T	A	5: 109,201,560 (GRCm39)	T315S	probably benign	Het
Zcchc14	T	C	8: 122,331,378 (GRCm39)		probably benign	Het
Zfp146	T	C	7: 29,861,818 (GRCm39)	S75G	probably benign	Het
Zfp994	A	G	17: 22,420,254 (GRCm39)	Y232H	probably damaging	Het

Other mutations in Stx16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Stx16	APN	2	173,934,202 (GRCm39)	missense	probably damaging	1.00
IGL01626:Stx16	APN	2	173,935,813 (GRCm39)	missense	probably damaging	1.00
IGL03052:Stx16	UTSW	2	173,934,231 (GRCm39)	missense	probably benign	0.01
R0257:Stx16	UTSW	2	173,938,754 (GRCm39)	missense	probably benign	0.39
R4929:Stx16	UTSW	2	173,938,721 (GRCm39)	missense	possibly damaging	0.94
R5728:Stx16	UTSW	2	173,935,292 (GRCm39)	missense	probably damaging	0.98
R5729:Stx16	UTSW	2	173,935,292 (GRCm39)	missense	probably damaging	0.98
R5772:Stx16	UTSW	2	173,935,292 (GRCm39)	missense	probably damaging	0.98
R5774:Stx16	UTSW	2	173,935,292 (GRCm39)	missense	probably damaging	0.98
R5776:Stx16	UTSW	2	173,935,292 (GRCm39)	missense	probably damaging	0.98
R6147:Stx16	UTSW	2	173,932,480 (GRCm39)	missense	probably damaging	1.00
R6837:Stx16	UTSW	2	173,935,795 (GRCm39)	missense	probably benign	0.09
R8151:Stx16	UTSW	2	173,935,284 (GRCm39)	missense	possibly damaging	0.70
R8675:Stx16	UTSW	2	173,934,255 (GRCm39)	missense	probably benign	0.04
R9468:Stx16	UTSW	2	173,933,327 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATGCAAGCAAGGCTCCC -3'
(R):5'- TGTAGGCCTCTGTGACGACTAG -3'

Sequencing Primer
(F):5'- CTTTAGACTGTTTAGGGGCCTCC -3'
(R):5'- CTCTGTGACGACTAGGAGGG -3'

Posted On

2016-11-21