Incidental Mutation 'R5746:Gba2'
ID445779
Institutional Source Beutler Lab
Gene Symbol Gba2
Ensembl Gene ENSMUSG00000028467
Gene Nameglucosidase beta 2
Synonymsbile acid
MMRRC Submission 043199-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5746 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43566928-43578873 bp(-) (GRCm38)
Type of Mutationunclassified (1668 bp from exon)
DNA Base Change (assembly) T to C at 43568465 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030189] [ENSMUST00000102944] [ENSMUST00000130443] [ENSMUST00000132631] [ENSMUST00000167751]
Predicted Effect probably damaging
Transcript: ENSMUST00000030189
AA Change: Y667C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030189
Gene: ENSMUSG00000028467
AA Change: Y667C

DomainStartEndE-ValueType
Pfam:GBA2_N 142 446 9.4e-106 PFAM
Pfam:DUF608 512 879 1.3e-153 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102944
SMART Domains Protein: ENSMUSP00000100008
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 132 147 N/A INTRINSIC
BRLZ 158 222 2.03e-15 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128403
Predicted Effect probably benign
Transcript: ENSMUST00000130443
SMART Domains Protein: ENSMUSP00000119589
Gene: ENSMUSG00000028467

DomainStartEndE-ValueType
Pfam:GBA2_N 142 180 5.6e-13 PFAM
Pfam:GBA2_N 178 227 1.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159923
Predicted Effect probably null
Transcript: ENSMUST00000167751
SMART Domains Protein: ENSMUSP00000129401
Gene: ENSMUSG00000028466

DomainStartEndE-ValueType
low complexity region 54 83 N/A INTRINSIC
low complexity region 156 171 N/A INTRINSIC
BRLZ 182 246 2.03e-15 SMART
low complexity region 264 277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microsomal beta-glucosidase that catalyzes the hydrolysis of bile acid 3-O-glucosides as endogenous compounds. Studies to determine subcellular localization of this protein in the liver indicated that the enzyme was mainly enriched in the microsomal fraction where it appeared to be confined to the endoplasmic reticulum. This putative transmembrane protein is thought to play a role in carbohydrate transport and metabolism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit accumulation of glucosylceramides in multiple tissues, and show impaired male fertility associated with globozoospermia, oligozoospermia, reduced sperm motility, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 A G 3: 105,907,810 E292G possibly damaging Het
Ank1 C T 8: 23,116,596 T1187I probably damaging Het
Ankrd16 T A 2: 11,784,367 I255K probably damaging Het
Atp6ap1l T C 13: 90,883,579 N328S probably benign Het
Cbln3 A G 14: 55,883,144 S144P probably damaging Het
Cdh12 T A 15: 21,358,724 L78Q probably null Het
Cpsf1 C T 15: 76,599,837 R761H probably benign Het
Cyp2d10 T G 15: 82,405,271 E213D probably benign Het
Glb1l2 G A 9: 26,796,790 A29V probably benign Het
Gm11149 C T 9: 49,546,194 G393S probably damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Kcnma1 T C 14: 23,494,567 N574S probably damaging Het
Kdm2b A G 5: 122,879,364 V1099A probably damaging Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Ly6g A T 15: 75,156,747 N19Y possibly damaging Het
Nexn TCTTCCTTC TCTTC 3: 152,242,876 probably benign Het
Nod2 T C 8: 88,664,342 S411P probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpn14 G A 1: 189,846,413 probably null Het
Smg6 G A 11: 75,139,287 G211E probably damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d15 T C 10: 115,210,279 S440G probably damaging Het
Tpm2 A G 4: 43,519,731 V85A possibly damaging Het
Ttf1 G T 2: 29,065,742 A373S probably damaging Het
Vmn2r11 T A 5: 109,053,694 T315S probably benign Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Zfp146 T C 7: 30,162,393 S75G probably benign Het
Zfp994 A G 17: 22,201,273 Y232H probably damaging Het
Other mutations in Gba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Gba2 APN 4 43568477 missense probably damaging 1.00
IGL01577:Gba2 APN 4 43573753 nonsense probably null
IGL02066:Gba2 APN 4 43570175 missense probably benign 0.18
IGL02126:Gba2 APN 4 43567918 critical splice acceptor site probably null
IGL02243:Gba2 APN 4 43568719 missense probably benign 0.13
IGL02474:Gba2 APN 4 43568538 missense possibly damaging 0.69
IGL02567:Gba2 APN 4 43567281 missense probably benign
IGL02628:Gba2 APN 4 43568919 missense probably benign 0.01
IGL02706:Gba2 APN 4 43567257 missense probably benign 0.01
IGL02795:Gba2 APN 4 43578331 missense probably damaging 1.00
R0389:Gba2 UTSW 4 43570832 missense probably damaging 1.00
R0555:Gba2 UTSW 4 43569927 missense probably damaging 1.00
R0650:Gba2 UTSW 4 43570424 unclassified probably null
R1603:Gba2 UTSW 4 43567823 missense probably damaging 1.00
R1628:Gba2 UTSW 4 43570118 missense probably benign 0.00
R1664:Gba2 UTSW 4 43578080 missense probably benign 0.01
R1686:Gba2 UTSW 4 43573869 splice site probably benign
R1730:Gba2 UTSW 4 43578242 missense probably benign 0.01
R2036:Gba2 UTSW 4 43568118 unclassified probably benign
R2061:Gba2 UTSW 4 43574029 nonsense probably null
R2259:Gba2 UTSW 4 43570107 missense probably benign
R2847:Gba2 UTSW 4 43568000 unclassified probably null
R3026:Gba2 UTSW 4 43578308 missense possibly damaging 0.95
R3617:Gba2 UTSW 4 43573803 missense probably damaging 1.00
R4225:Gba2 UTSW 4 43569464 unclassified probably benign
R4346:Gba2 UTSW 4 43571337 missense probably benign 0.04
R4601:Gba2 UTSW 4 43573810 missense probably damaging 1.00
R4611:Gba2 UTSW 4 43568092 missense probably damaging 1.00
R4664:Gba2 UTSW 4 43568619 unclassified probably benign
R4784:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R4785:Gba2 UTSW 4 43568315 missense probably damaging 1.00
R5079:Gba2 UTSW 4 43568640 unclassified probably benign
R5327:Gba2 UTSW 4 43574063 missense probably damaging 1.00
R6052:Gba2 UTSW 4 43568330 missense probably damaging 1.00
R6485:Gba2 UTSW 4 43574118 missense probably damaging 1.00
R7073:Gba2 UTSW 4 43573753 missense probably damaging 1.00
R7112:Gba2 UTSW 4 43568453 missense probably benign 0.01
R7472:Gba2 UTSW 4 43568967 missense probably benign 0.44
RF007:Gba2 UTSW 4 43569894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAAGCAAACCTCTCCTG -3'
(R):5'- TGTGTCCAGTATACCAGGGATG -3'

Sequencing Primer
(F):5'- AAACCTCTCCTGGACATCTTGGG -3'
(R):5'- TCCAGTATACCAGGGATGTAGCTG -3'
Posted On2016-11-21