Incidental Mutation 'R0029:Impg1'
ID44578
Institutional Source Beutler Lab
Gene Symbol Impg1
Ensembl Gene ENSMUSG00000032343
Gene Nameinterphotoreceptor matrix proteoglycan 1
SynonymsIMP150, SPACR, A930015H12Rik
MMRRC Submission 038323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0029 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location80313330-80465481 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80398371 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 138 (D138G)
Ref Sequence ENSEMBL: ENSMUSP00000082395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085289] [ENSMUST00000113250] [ENSMUST00000185068]
Predicted Effect probably damaging
Transcript: ENSMUST00000085289
AA Change: D138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: D138G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 158 273 8.68e-1 SMART
low complexity region 353 374 N/A INTRINSIC
SEA 494 616 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113250
AA Change: D215G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: D215G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SEA 235 350 8.68e-1 SMART
low complexity region 430 451 N/A INTRINSIC
SEA 571 693 1.37e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185068
AA Change: D138G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139151
Gene: ENSMUSG00000032343
AA Change: D138G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:SEA 157 216 1.2e-13 PFAM
Meta Mutation Damage Score 0.0861 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Axin2 A G 11: 108,924,047 T254A probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gapvd1 T A 2: 34,678,141 I1404F probably damaging Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lipm T C 19: 34,116,548 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc26a2 G A 18: 61,202,310 P24S possibly damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Tmem63a A G 1: 180,962,466 Y401C probably benign Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Impg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Impg1 APN 9 80322829 missense probably benign 0.02
IGL01733:Impg1 APN 9 80341924 missense probably damaging 0.99
IGL02333:Impg1 APN 9 80440755 missense possibly damaging 0.74
IGL03097:Impg1 UTSW 9 80379952 missense possibly damaging 0.48
R0021:Impg1 UTSW 9 80435426 missense probably damaging 1.00
R0029:Impg1 UTSW 9 80398371 missense probably damaging 1.00
R0108:Impg1 UTSW 9 80322848 missense possibly damaging 0.63
R0201:Impg1 UTSW 9 80345561 missense probably damaging 1.00
R0271:Impg1 UTSW 9 80386879 splice site probably benign
R0316:Impg1 UTSW 9 80342065 missense probably damaging 1.00
R0492:Impg1 UTSW 9 80345308 missense possibly damaging 0.74
R0633:Impg1 UTSW 9 80394155 missense possibly damaging 0.72
R0705:Impg1 UTSW 9 80379979 missense probably damaging 1.00
R0962:Impg1 UTSW 9 80381741 missense probably benign 0.23
R1264:Impg1 UTSW 9 80314393 missense probably benign 0.31
R1707:Impg1 UTSW 9 80378517 splice site probably null
R2017:Impg1 UTSW 9 80440667 missense probably damaging 1.00
R3904:Impg1 UTSW 9 80345585 missense possibly damaging 0.76
R3960:Impg1 UTSW 9 80440864 missense probably benign 0.00
R4231:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4233:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4235:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4236:Impg1 UTSW 9 80345329 missense probably damaging 1.00
R4490:Impg1 UTSW 9 80394059 missense probably damaging 1.00
R4592:Impg1 UTSW 9 80440854 missense probably benign 0.05
R4701:Impg1 UTSW 9 80314400 missense probably benign 0.07
R4785:Impg1 UTSW 9 80398450 missense probably benign 0.01
R4796:Impg1 UTSW 9 80394095 missense probably damaging 0.99
R4923:Impg1 UTSW 9 80345078 nonsense probably null
R4923:Impg1 UTSW 9 80345545 missense probably damaging 0.98
R5468:Impg1 UTSW 9 80465265 missense probably benign 0.05
R5596:Impg1 UTSW 9 80345218 missense probably benign 0.24
R6001:Impg1 UTSW 9 80316172 missense probably benign 0.12
R6156:Impg1 UTSW 9 80322824 missense probably damaging 1.00
R6315:Impg1 UTSW 9 80394074 missense probably benign 0.21
R6419:Impg1 UTSW 9 80380018 missense probably benign 0.38
R6880:Impg1 UTSW 9 80404800 missense probably damaging 1.00
R7013:Impg1 UTSW 9 80378494 missense probably damaging 1.00
Z1176:Impg1 UTSW 9 80378467 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- gacacatgcaggtgaaCATGCATAC -3'
(R):5'- GCTGTGAGCAAAAGGCACACTG -3'

Sequencing Primer
(F):5'- gtgaaCATGCATACACGCATTTG -3'
(R):5'- AGATGTTTCCAGGATGTCCC -3'
Posted On2013-06-11