Mutagenetix > Incidental Mutations

Incidental Mutation 'R5746:Vmn2r11'

445780

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r11

Ensembl Gene

ENSMUSG00000091450

Gene Name

vomeronasal 2, receptor 11

Synonyms

EG384219

MMRRC Submission

043199-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R5746 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109046873-109059452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109053694 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 315 (T315S)

Ref Sequence

ENSEMBL: ENSMUSP00000133218 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164875]

Predicted Effect

probably benign
Transcript: ENSMUST00000164875
AA Change: T315S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133218
Gene: ENSMUSG00000091450
AA Change: T315S

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	167	475	1.6e-29	PFAM
Pfam:NCD3G	520	574	9.1e-19	PFAM
Pfam:7tm_3	607	842	4.6e-55	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adora3	A	G	3: 105,907,810	E292G	possibly damaging	Het
Ank1	C	T	8: 23,116,596	T1187I	probably damaging	Het
Ankrd16	T	A	2: 11,784,367	I255K	probably damaging	Het
Atp6ap1l	T	C	13: 90,883,579	N328S	probably benign	Het
Cbln3	A	G	14: 55,883,144	S144P	probably damaging	Het
Cdh12	T	A	15: 21,358,724	L78Q	probably null	Het
Cpsf1	C	T	15: 76,599,837	R761H	probably benign	Het
Cyp2d10	T	G	15: 82,405,271	E213D	probably benign	Het
Gba2	T	C	4: 43,568,465		probably null	Het
Glb1l2	G	A	9: 26,796,790	A29V	probably benign	Het
Gm11149	C	T	9: 49,546,194	G393S	probably damaging	Het
Igkv6-29	C	A	6: 70,138,600	G70V	possibly damaging	Het
Kcnma1	T	C	14: 23,494,567	N574S	probably damaging	Het
Kdm2b	A	G	5: 122,879,364	V1099A	probably damaging	Het
Kel	C	T	6: 41,699,027	G243E	probably damaging	Het
Ly6g	A	T	15: 75,156,747	N19Y	possibly damaging	Het
Nexn	TCTTCCTTC	TCTTC	3: 152,242,876		probably benign	Het
Nod2	T	C	8: 88,664,342	S411P	probably damaging	Het
Plekha6	G	C	1: 133,272,307	R208P	possibly damaging	Het
Ptpn14	G	A	1: 189,846,413		probably null	Het
Smg6	G	A	11: 75,139,287	G211E	probably damaging	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Tbc1d15	T	C	10: 115,210,279	S440G	probably damaging	Het
Tpm2	A	G	4: 43,519,731	V85A	possibly damaging	Het
Ttf1	G	T	2: 29,065,742	A373S	probably damaging	Het
Zcchc14	T	C	8: 121,604,639		probably benign	Het
Zfp146	T	C	7: 30,162,393	S75G	probably benign	Het
Zfp994	A	G	17: 22,201,273	Y232H	probably damaging	Het

Other mutations in Vmn2r11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00925:Vmn2r11	APN	5	109047019	missense	probably benign	0.00
IGL01677:Vmn2r11	APN	5	109053957	missense	possibly damaging	0.50
IGL02048:Vmn2r11	APN	5	109054792	missense	probably benign	0.00
IGL02559:Vmn2r11	APN	5	109052180	missense	probably damaging	0.98
IGL02879:Vmn2r11	APN	5	109053838	missense	possibly damaging	0.95
IGL03084:Vmn2r11	APN	5	109059343	missense	probably benign	0.00
IGL03163:Vmn2r11	APN	5	109053826	missense	probably benign	0.41
IGL03289:Vmn2r11	APN	5	109048922	splice site	probably benign
IGL03294:Vmn2r11	APN	5	109054069	missense	probably benign	0.22
R0233:Vmn2r11	UTSW	5	109054102	missense	probably benign	0.16
R0233:Vmn2r11	UTSW	5	109054102	missense	probably benign	0.16
R0421:Vmn2r11	UTSW	5	109059428	missense	probably benign	0.00
R0549:Vmn2r11	UTSW	5	109052097	missense	possibly damaging	0.80
R0628:Vmn2r11	UTSW	5	109047731	missense	possibly damaging	0.88
R1523:Vmn2r11	UTSW	5	109053841	missense	probably benign	0.25
R1660:Vmn2r11	UTSW	5	109053858	missense	possibly damaging	0.79
R1827:Vmn2r11	UTSW	5	109052072	missense	probably benign	0.01
R1913:Vmn2r11	UTSW	5	109054788	missense	probably benign
R2260:Vmn2r11	UTSW	5	109053791	nonsense	probably null
R2400:Vmn2r11	UTSW	5	109052062	missense	probably benign	0.03
R3933:Vmn2r11	UTSW	5	109053394	missense	probably damaging	0.97
R4091:Vmn2r11	UTSW	5	109054750	critical splice donor site	probably null
R4624:Vmn2r11	UTSW	5	109052235	missense	probably damaging	0.99
R4762:Vmn2r11	UTSW	5	109047570	missense	probably damaging	1.00
R5256:Vmn2r11	UTSW	5	109054792	missense	probably benign	0.26
R5370:Vmn2r11	UTSW	5	109047555	missense	probably damaging	1.00
R5419:Vmn2r11	UTSW	5	109059358	missense	possibly damaging	0.55
R5516:Vmn2r11	UTSW	5	109047166	missense	probably damaging	0.98
R5643:Vmn2r11	UTSW	5	109047003	missense	probably damaging	1.00
R5671:Vmn2r11	UTSW	5	109054906	missense	probably benign	0.03
R5679:Vmn2r11	UTSW	5	109054842	missense	probably benign	0.00
R5739:Vmn2r11	UTSW	5	109059248	critical splice donor site	probably null
R5995:Vmn2r11	UTSW	5	109047055	missense	probably damaging	1.00
R6147:Vmn2r11	UTSW	5	109054834	missense	probably benign	0.04
R6220:Vmn2r11	UTSW	5	109053568	missense	probably benign	0.09
R6374:Vmn2r11	UTSW	5	109053813	missense	possibly damaging	0.65
R6491:Vmn2r11	UTSW	5	109048934	missense	possibly damaging	0.95
R6804:Vmn2r11	UTSW	5	109053484	missense	probably damaging	1.00
R6814:Vmn2r11	UTSW	5	109047110	missense	possibly damaging	0.81
R6872:Vmn2r11	UTSW	5	109047110	missense	possibly damaging	0.81
R7014:Vmn2r11	UTSW	5	109053423	missense	probably damaging	1.00
R7041:Vmn2r11	UTSW	5	109054950	missense	probably damaging	1.00
R7043:Vmn2r11	UTSW	5	109052232	missense	probably benign	0.00
R7050:Vmn2r11	UTSW	5	109054791	missense	probably benign	0.05
R7184:Vmn2r11	UTSW	5	109053415	missense	probably damaging	1.00
R7388:Vmn2r11	UTSW	5	109054876	missense	probably benign	0.05
R7477:Vmn2r11	UTSW	5	109059348	missense	possibly damaging	0.67
R7524:Vmn2r11	UTSW	5	109053982	missense	probably benign	0.01
R7682:Vmn2r11	UTSW	5	109047615	missense	probably benign	0.02
R7715:Vmn2r11	UTSW	5	109047441	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCTGTCCATTCCGATGTG -3'
(R):5'- CATGCAGATATACATGACAAGGGC -3'

Sequencing Primer
(F):5'- CCATTTTGCTATAGCTGTTCATTGAG -3'
(R):5'- CAGCTTTAGAAGGTGGGA -3'

Posted On

2016-11-21