Incidental Mutation 'R5746:Zfp146'
ID 445784
Institutional Source Beutler Lab
Gene Symbol Zfp146
Ensembl Gene ENSMUSG00000037029
Gene Name zinc finger protein 146
Synonyms OZF
MMRRC Submission 043199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R5746 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30161269-30169750 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30162393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 75 (S75G)
Ref Sequence ENSEMBL: ENSMUSP00000058588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062181]
AlphaFold Q8BQN6
Predicted Effect probably benign
Transcript: ENSMUST00000062181
AA Change: S75G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000058588
Gene: ENSMUSG00000037029
AA Change: S75G

DomainStartEndE-ValueType
ZnF_C2H2 16 38 1.01e-1 SMART
ZnF_C2H2 44 66 5.5e-3 SMART
ZnF_C2H2 72 94 3.44e-4 SMART
ZnF_C2H2 100 122 2.27e-4 SMART
ZnF_C2H2 128 150 1.98e-4 SMART
ZnF_C2H2 156 178 3.89e-3 SMART
ZnF_C2H2 184 206 6.99e-5 SMART
ZnF_C2H2 212 234 1.6e-4 SMART
ZnF_C2H2 240 262 5.5e-3 SMART
ZnF_C2H2 268 290 1.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136508
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 A G 3: 105,907,810 E292G possibly damaging Het
Ank1 C T 8: 23,116,596 T1187I probably damaging Het
Ankrd16 T A 2: 11,784,367 I255K probably damaging Het
Atp6ap1l T C 13: 90,883,579 N328S probably benign Het
Cbln3 A G 14: 55,883,144 S144P probably damaging Het
Cdh12 T A 15: 21,358,724 L78Q probably null Het
Cpsf1 C T 15: 76,599,837 R761H probably benign Het
Cyp2d10 T G 15: 82,405,271 E213D probably benign Het
Gba2 T C 4: 43,568,465 probably null Het
Glb1l2 G A 9: 26,796,790 A29V probably benign Het
Gm11149 C T 9: 49,546,194 G393S probably damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Kcnma1 T C 14: 23,494,567 N574S probably damaging Het
Kdm2b A G 5: 122,879,364 V1099A probably damaging Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Ly6g A T 15: 75,156,747 N19Y possibly damaging Het
Nexn TCTTCCTTC TCTTC 3: 152,242,876 probably benign Het
Nod2 T C 8: 88,664,342 S411P probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpn14 G A 1: 189,846,413 probably null Het
Smg6 G A 11: 75,139,287 G211E probably damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d15 T C 10: 115,210,279 S440G probably damaging Het
Tpm2 A G 4: 43,519,731 V85A possibly damaging Het
Ttf1 G T 2: 29,065,742 A373S probably damaging Het
Vmn2r11 T A 5: 109,053,694 T315S probably benign Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Zfp994 A G 17: 22,201,273 Y232H probably damaging Het
Other mutations in Zfp146
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Zfp146 APN 7 30162480 missense possibly damaging 0.51
IGL02485:Zfp146 APN 7 30162590 missense probably benign
IGL02796:Zfp146 UTSW 7 30162558 missense probably benign 0.01
R2043:Zfp146 UTSW 7 30162239 missense possibly damaging 0.92
R4166:Zfp146 UTSW 7 30162440 missense possibly damaging 0.50
R4385:Zfp146 UTSW 7 30162422 missense probably benign
R5270:Zfp146 UTSW 7 30162475 missense probably benign 0.03
R5271:Zfp146 UTSW 7 30162475 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATGCACAATCAGCGACGTG -3'
(R):5'- AAGCCCCTTTGCCTGTAAGG -3'

Sequencing Primer
(F):5'- CAGGTACTTTTTCTGGCCAAAAGC -3'
(R):5'- GTATGTGGGAAACTCTTCAGCCAC -3'
Posted On 2016-11-21