Incidental Mutation 'R5746:Tbc1d15'
ID445792
Institutional Source Beutler Lab
Gene Symbol Tbc1d15
Ensembl Gene ENSMUSG00000020130
Gene NameTBC1 domain family, member 15
SynonymsLy6dl, 4432405K22Rik
MMRRC Submission 043199-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R5746 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location115197872-115251467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115210279 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 440 (S440G)
Ref Sequence ENSEMBL: ENSMUSP00000020339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020339]
Predicted Effect probably damaging
Transcript: ENSMUST00000020339
AA Change: S440G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020339
Gene: ENSMUSG00000020130
AA Change: S440G

DomainStartEndE-ValueType
Pfam:DUF3548 6 224 1.3e-87 PFAM
TBC 326 564 1.14e-50 SMART
Blast:TBC 602 671 5e-23 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217886
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-like proteins in brain-GTPase activating protein superfamily that share a conserved Tre-2/Bub2/Cdc16 domain. The encoded protein interacts with Ras-like protein in brain 5A and may function as a regulator of intracellular trafficking. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 A G 3: 105,907,810 E292G possibly damaging Het
Ank1 C T 8: 23,116,596 T1187I probably damaging Het
Ankrd16 T A 2: 11,784,367 I255K probably damaging Het
Atp6ap1l T C 13: 90,883,579 N328S probably benign Het
Cbln3 A G 14: 55,883,144 S144P probably damaging Het
Cdh12 T A 15: 21,358,724 L78Q probably null Het
Cpsf1 C T 15: 76,599,837 R761H probably benign Het
Cyp2d10 T G 15: 82,405,271 E213D probably benign Het
Gba2 T C 4: 43,568,465 probably null Het
Glb1l2 G A 9: 26,796,790 A29V probably benign Het
Gm11149 C T 9: 49,546,194 G393S probably damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Kcnma1 T C 14: 23,494,567 N574S probably damaging Het
Kdm2b A G 5: 122,879,364 V1099A probably damaging Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Ly6g A T 15: 75,156,747 N19Y possibly damaging Het
Nexn TCTTCCTTC TCTTC 3: 152,242,876 probably benign Het
Nod2 T C 8: 88,664,342 S411P probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpn14 G A 1: 189,846,413 probably null Het
Smg6 G A 11: 75,139,287 G211E probably damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tpm2 A G 4: 43,519,731 V85A possibly damaging Het
Ttf1 G T 2: 29,065,742 A373S probably damaging Het
Vmn2r11 T A 5: 109,053,694 T315S probably benign Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Zfp146 T C 7: 30,162,393 S75G probably benign Het
Zfp994 A G 17: 22,201,273 Y232H probably damaging Het
Other mutations in Tbc1d15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Tbc1d15 APN 10 115209641 nonsense probably null
IGL01161:Tbc1d15 APN 10 115202530 missense probably benign 0.01
IGL02458:Tbc1d15 APN 10 115229206 missense probably damaging 0.99
IGL03145:Tbc1d15 APN 10 115202516 missense probably benign 0.03
R0140:Tbc1d15 UTSW 10 115220219 missense probably damaging 0.99
R0466:Tbc1d15 UTSW 10 115219172 missense probably damaging 1.00
R0617:Tbc1d15 UTSW 10 115239299 missense probably damaging 1.00
R0633:Tbc1d15 UTSW 10 115220310 missense probably benign 0.00
R1526:Tbc1d15 UTSW 10 115203230 missense probably benign 0.38
R1699:Tbc1d15 UTSW 10 115220314 missense probably benign 0.05
R1727:Tbc1d15 UTSW 10 115210225 missense probably damaging 1.00
R2063:Tbc1d15 UTSW 10 115229173 missense probably benign
R2111:Tbc1d15 UTSW 10 115240914 missense possibly damaging 0.88
R4751:Tbc1d15 UTSW 10 115202587 missense probably damaging 1.00
R5318:Tbc1d15 UTSW 10 115208969 nonsense probably null
R5480:Tbc1d15 UTSW 10 115233218 missense probably damaging 1.00
R5891:Tbc1d15 UTSW 10 115220308 missense probably benign 0.20
R6012:Tbc1d15 UTSW 10 115219207 missense probably damaging 1.00
R6306:Tbc1d15 UTSW 10 115233243 missense possibly damaging 0.91
R6989:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
R7792:Tbc1d15 UTSW 10 115221587 missense possibly damaging 0.91
R8134:Tbc1d15 UTSW 10 115209569 missense probably damaging 1.00
R8231:Tbc1d15 UTSW 10 115229140 missense probably damaging 1.00
R8507:Tbc1d15 UTSW 10 115202502 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACATTTCAAGCTCCACCCTAGTG -3'
(R):5'- TGACTACCGTGGCACTCAAAC -3'

Sequencing Primer
(F):5'- GGCTAGATATTACAATCAGTCTCAGG -3'
(R):5'- GTGGCACTCAAACAGCTCATATTTC -3'
Posted On2016-11-21