Incidental Mutation 'R5746:Atp6ap1l'
ID445794
Institutional Source Beutler Lab
Gene Symbol Atp6ap1l
Ensembl Gene ENSMUSG00000078958
Gene NameATPase, H+ transporting, lysosomal accessory protein 1-like
SynonymsEG435376
MMRRC Submission 043199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5746 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location90883433-90905355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90883579 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 328 (N328S)
Ref Sequence ENSEMBL: ENSMUSP00000105168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109541] [ENSMUST00000182446]
Predicted Effect probably benign
Transcript: ENSMUST00000109541
AA Change: N328S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105168
Gene: ENSMUSG00000078958
AA Change: N328S

DomainStartEndE-ValueType
Pfam:Lamp 19 287 2.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182104
Predicted Effect probably benign
Transcript: ENSMUST00000182446
Predicted Effect probably benign
Transcript: ENSMUST00000183162
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora3 A G 3: 105,907,810 E292G possibly damaging Het
Ank1 C T 8: 23,116,596 T1187I probably damaging Het
Ankrd16 T A 2: 11,784,367 I255K probably damaging Het
Cbln3 A G 14: 55,883,144 S144P probably damaging Het
Cdh12 T A 15: 21,358,724 L78Q probably null Het
Cpsf1 C T 15: 76,599,837 R761H probably benign Het
Cyp2d10 T G 15: 82,405,271 E213D probably benign Het
Gba2 T C 4: 43,568,465 probably null Het
Glb1l2 G A 9: 26,796,790 A29V probably benign Het
Gm11149 C T 9: 49,546,194 G393S probably damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Kcnma1 T C 14: 23,494,567 N574S probably damaging Het
Kdm2b A G 5: 122,879,364 V1099A probably damaging Het
Kel C T 6: 41,699,027 G243E probably damaging Het
Ly6g A T 15: 75,156,747 N19Y possibly damaging Het
Nexn TCTTCCTTC TCTTC 3: 152,242,876 probably benign Het
Nod2 T C 8: 88,664,342 S411P probably damaging Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Ptpn14 G A 1: 189,846,413 probably null Het
Smg6 G A 11: 75,139,287 G211E probably damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d15 T C 10: 115,210,279 S440G probably damaging Het
Tpm2 A G 4: 43,519,731 V85A possibly damaging Het
Ttf1 G T 2: 29,065,742 A373S probably damaging Het
Vmn2r11 T A 5: 109,053,694 T315S probably benign Het
Zcchc14 T C 8: 121,604,639 probably benign Het
Zfp146 T C 7: 30,162,393 S75G probably benign Het
Zfp994 A G 17: 22,201,273 Y232H probably damaging Het
Other mutations in Atp6ap1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02823:Atp6ap1l APN 13 90899525 missense probably benign 0.00
R0545:Atp6ap1l UTSW 13 90883663 missense probably benign 0.03
R1224:Atp6ap1l UTSW 13 90886556 nonsense probably null
R1425:Atp6ap1l UTSW 13 90899519 missense possibly damaging 0.69
R1453:Atp6ap1l UTSW 13 90898747 missense probably benign 0.36
R1784:Atp6ap1l UTSW 13 90905281 missense probably damaging 0.96
R1853:Atp6ap1l UTSW 13 90883588 missense probably damaging 1.00
R1854:Atp6ap1l UTSW 13 90883588 missense probably damaging 1.00
R1932:Atp6ap1l UTSW 13 90883687 missense probably damaging 1.00
R4127:Atp6ap1l UTSW 13 90898707 missense probably damaging 0.98
R5123:Atp6ap1l UTSW 13 90898898 intron probably benign
R5352:Atp6ap1l UTSW 13 90883756 missense probably damaging 1.00
R6492:Atp6ap1l UTSW 13 90883722 missense probably damaging 1.00
R6687:Atp6ap1l UTSW 13 90886723 missense probably benign 0.09
R7150:Atp6ap1l UTSW 13 90883729 missense probably damaging 1.00
R7358:Atp6ap1l UTSW 13 90883807 missense probably damaging 1.00
R7595:Atp6ap1l UTSW 13 90891016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGCCCTAGACCTACCTAG -3'
(R):5'- GCTATTCTGATCGGTCTGGC -3'

Sequencing Primer
(F):5'- TGCCCTAGACCTACCTAGCAAAG -3'
(R):5'- GATCGGTCTGGCCATGTCTC -3'
Posted On2016-11-21