Incidental Mutation 'R5747:Mob4'
ID445802
Institutional Source Beutler Lab
Gene Symbol Mob4
Ensembl Gene ENSMUSG00000025979
Gene NameMOB family member 4, phocein
SynonymsMobkl3, Prei3
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location55131231-55154899 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55148578 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 68 (M68V)
Ref Sequence ENSEMBL: ENSMUSP00000124151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027122] [ENSMUST00000159311] [ENSMUST00000161122] [ENSMUST00000162364] [ENSMUST00000162553]
Predicted Effect probably damaging
Transcript: ENSMUST00000027122
AA Change: M58V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027122
Gene: ENSMUSG00000025979
AA Change: M58V

DomainStartEndE-ValueType
Pfam:Mob1_phocein 28 168 1.2e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159311
AA Change: M79V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124790
Gene: ENSMUSG00000025979
AA Change: M79V

DomainStartEndE-ValueType
Pfam:Mob1_phocein 19 189 9.3e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159743
Predicted Effect probably benign
Transcript: ENSMUST00000161122
Predicted Effect probably damaging
Transcript: ENSMUST00000162364
AA Change: M100V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125415
Gene: ENSMUSG00000025979
AA Change: M100V

DomainStartEndE-ValueType
Mob1_phocein 42 209 1.89e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162553
AA Change: M68V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124151
Gene: ENSMUSG00000025979
AA Change: M68V

DomainStartEndE-ValueType
Pfam:Mob1_phocein 8 178 3.9e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187422
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Mob4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03340:Mob4 APN 1 55136708 missense possibly damaging 0.50
R4756:Mob4 UTSW 1 55152696 missense probably damaging 0.98
R4831:Mob4 UTSW 1 55152740 missense probably benign 0.01
R4832:Mob4 UTSW 1 55145252 intron probably benign
R4876:Mob4 UTSW 1 55152836 unclassified probably benign
R4972:Mob4 UTSW 1 55151002 missense possibly damaging 0.96
R6717:Mob4 UTSW 1 55136713 missense possibly damaging 0.91
R6774:Mob4 UTSW 1 55148429 intron probably null
R6925:Mob4 UTSW 1 55152722 nonsense probably null
R7447:Mob4 UTSW 1 55131466 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTGCTGTCAAACTTCAGGTAG -3'
(R):5'- ATCTCCACGGGTGCATGTAC -3'

Sequencing Primer
(F):5'- GCTGTCAAACTTCAGGTAGTATTTTC -3'
(R):5'- CCAAGGGCTTATCTCCTGAAGATG -3'
Posted On2016-11-21