Incidental Mutation 'R5747:Wdr31'
ID445813
Institutional Source Beutler Lab
Gene Symbol Wdr31
Ensembl Gene ENSMUSG00000028391
Gene NameWD repeat domain 31
Synonyms
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62448653-62470896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62463400 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 65 (V65I)
Ref Sequence ENSEMBL: ENSMUSP00000123624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030087] [ENSMUST00000107452] [ENSMUST00000120095] [ENSMUST00000132263] [ENSMUST00000135811] [ENSMUST00000155522]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030087
AA Change: V65I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391
AA Change: V65I

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107452
AA Change: V64I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391
AA Change: V64I

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000120095
AA Change: V65I

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391
AA Change: V65I

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132263
SMART Domains Protein: ENSMUSP00000120684
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 16 55 5.31e-4 SMART
Blast:WD40 58 100 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153615
Predicted Effect probably damaging
Transcript: ENSMUST00000155522
AA Change: V65I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123624
Gene: ENSMUSG00000028391
AA Change: V65I

DomainStartEndE-ValueType
Blast:WD40 51 83 3e-16 BLAST
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Wdr31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Wdr31 APN 4 62457520 missense probably damaging 1.00
IGL01315:Wdr31 APN 4 62455837 missense probably damaging 1.00
IGL02345:Wdr31 APN 4 62458846 missense possibly damaging 0.89
IGL03192:Wdr31 APN 4 62453912 missense possibly damaging 0.73
R0045:Wdr31 UTSW 4 62464033 missense possibly damaging 0.81
R0257:Wdr31 UTSW 4 62460518 critical splice donor site probably null
R0486:Wdr31 UTSW 4 62453893 missense probably damaging 1.00
R1983:Wdr31 UTSW 4 62460603 missense probably damaging 1.00
R2081:Wdr31 UTSW 4 62455943 missense probably benign 0.00
R3620:Wdr31 UTSW 4 62457464 missense possibly damaging 0.95
R4256:Wdr31 UTSW 4 62457438 critical splice donor site probably null
R4303:Wdr31 UTSW 4 62460389 missense probably damaging 1.00
R4562:Wdr31 UTSW 4 62453922 missense probably damaging 1.00
R5986:Wdr31 UTSW 4 62455876 missense probably benign 0.02
R6170:Wdr31 UTSW 4 62463424 missense probably damaging 1.00
R6887:Wdr31 UTSW 4 62457565 missense probably benign 0.03
R7126:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7469:Wdr31 UTSW 4 62457531 missense probably damaging 0.99
R7653:Wdr31 UTSW 4 62463429 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGTAGGTGGCCTGACAAAG -3'
(R):5'- CACCCTTGCCTGAATTGATATC -3'

Sequencing Primer
(F):5'- GAGGTCCTCATGGAATCCTCATG -3'
(R):5'- GCCTGAATTGATATCACTGCCAC -3'
Posted On2016-11-21