Incidental Mutation 'R5747:Slc4a5'
ID445816
Institutional Source Beutler Lab
Gene Symbol Slc4a5
Ensembl Gene ENSMUSG00000068323
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 5
SynonymsC330016K18Rik
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.787) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83219828-83304945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83271029 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 521 (Y521N)
Ref Sequence ENSEMBL: ENSMUSP00000109533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039212] [ENSMUST00000113899] [ENSMUST00000113900]
Predicted Effect probably damaging
Transcript: ENSMUST00000039212
AA Change: Y406N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041007
Gene: ENSMUSG00000068323
AA Change: Y406N

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 5.2e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 1.1e-242 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113899
AA Change: Y406N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109532
Gene: ENSMUSG00000068323
AA Change: Y406N

DomainStartEndE-ValueType
Pfam:Band_3_cyto 25 292 2.9e-102 PFAM
low complexity region 321 350 N/A INTRINSIC
Pfam:HCO3_cotransp 364 884 5.3e-243 PFAM
transmembrane domain 891 913 N/A INTRINSIC
low complexity region 936 951 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113900
AA Change: Y521N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: Y521N

DomainStartEndE-ValueType
Pfam:Band_3_cyto 140 407 3.4e-106 PFAM
low complexity region 436 465 N/A INTRINSIC
Pfam:HCO3_cotransp 480 999 1.6e-224 PFAM
transmembrane domain 1006 1028 N/A INTRINSIC
low complexity region 1051 1066 N/A INTRINSIC
Meta Mutation Damage Score 0.9415 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Slc4a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Slc4a5 APN 6 83285899 missense probably damaging 1.00
IGL00473:Slc4a5 APN 6 83296597 missense probably damaging 1.00
IGL00861:Slc4a5 APN 6 83299471 missense probably benign
IGL01025:Slc4a5 APN 6 83262533 missense probably damaging 0.98
IGL01532:Slc4a5 APN 6 83273040 splice site probably null
IGL01991:Slc4a5 APN 6 83263543 missense possibly damaging 0.94
IGL02271:Slc4a5 APN 6 83271103 splice site probably benign
IGL02565:Slc4a5 APN 6 83299505 missense probably benign 0.00
IGL02669:Slc4a5 APN 6 83263543 missense possibly damaging 0.79
IGL02994:Slc4a5 APN 6 83272124 missense probably damaging 1.00
IGL03259:Slc4a5 APN 6 83270997 missense probably damaging 1.00
IGL03264:Slc4a5 APN 6 83261525 missense probably damaging 1.00
R0032:Slc4a5 UTSW 6 83273157 missense probably damaging 1.00
R0091:Slc4a5 UTSW 6 83277555 missense probably benign 0.00
R0281:Slc4a5 UTSW 6 83267567 splice site probably benign
R0366:Slc4a5 UTSW 6 83295872 missense probably benign 0.02
R0668:Slc4a5 UTSW 6 83271072 missense probably damaging 1.00
R1222:Slc4a5 UTSW 6 83280132 missense probably damaging 1.00
R1550:Slc4a5 UTSW 6 83271057 missense probably damaging 1.00
R1585:Slc4a5 UTSW 6 83265687 missense probably damaging 1.00
R1731:Slc4a5 UTSW 6 83296635 missense probably damaging 1.00
R1987:Slc4a5 UTSW 6 83273232 missense possibly damaging 0.95
R2103:Slc4a5 UTSW 6 83224681 missense probably benign 0.00
R2103:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2104:Slc4a5 UTSW 6 83297378 missense probably benign 0.00
R2176:Slc4a5 UTSW 6 83262560 missense probably damaging 0.98
R2920:Slc4a5 UTSW 6 83264387 missense probably damaging 1.00
R2964:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2965:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R2966:Slc4a5 UTSW 6 83296669 missense probably damaging 1.00
R3755:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R3756:Slc4a5 UTSW 6 83288303 missense probably benign 0.26
R4293:Slc4a5 UTSW 6 83260529 missense probably damaging 1.00
R4789:Slc4a5 UTSW 6 83270969 missense probably benign 0.05
R4823:Slc4a5 UTSW 6 83272133 missense probably damaging 1.00
R4854:Slc4a5 UTSW 6 83271017 missense probably benign 0.00
R5461:Slc4a5 UTSW 6 83285854 missense probably benign 0.29
R5707:Slc4a5 UTSW 6 83261415 missense probably benign 0.11
R5978:Slc4a5 UTSW 6 83277536 missense probably benign 0.01
R6126:Slc4a5 UTSW 6 83226265 missense probably benign 0.05
R6330:Slc4a5 UTSW 6 83226374 missense probably benign
R6564:Slc4a5 UTSW 6 83280060 missense possibly damaging 0.71
R6786:Slc4a5 UTSW 6 83296747 critical splice donor site probably null
R7443:Slc4a5 UTSW 6 83264315 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GGTAGAAAGAGTGTGACTCCATC -3'
(R):5'- ACCTAACTGTGATGTTGCGGC -3'

Sequencing Primer
(F):5'- AAAGAGTGTGACTCCATCTATCCCTG -3'
(R):5'- GTTGCGGCATTACAAACTGGACTC -3'
Posted On2016-11-21