Mutagenetix > Incidental Mutations

Incidental Mutation 'R5747:Grik2'

445826

Institutional Source

Beutler Lab

Gene Symbol

Grik2

Ensembl Gene

ENSMUSG00000056073

Gene Name

glutamate receptor, ionotropic, kainate 2 (beta 2)

Synonyms

Glurbeta2, Glur-6, Glur6

MMRRC Submission

043354-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5747 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49094833-49788766 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49523774 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 287 (T287A)

Ref Sequence

ENSEMBL: ENSMUSP00000151372 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218669] [ENSMUST00000218823] [ENSMUST00000220263]

Predicted Effect

probably benign
Transcript: ENSMUST00000079751
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: T287A

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105483
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101123
Gene: ENSMUSG00000056073
AA Change: T287A

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	298	3e-11	PFAM
Pfam:ANF_receptor	52	334	3.5e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105484
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: T287A

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105485
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: T287A

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	1.8e-11	PFAM
Pfam:ANF_receptor	52	395	8.3e-75	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000105486
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: T287A

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	44	386	3.8e-11	PFAM
Pfam:ANF_receptor	52	395	1.5e-74	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	6e-13	BLAST
low complexity region	875	891	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105487
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: T287A

Domain	Start	End	E-Value	Type
Pfam:Peripla_BP_6	46	386	5e-11	PFAM
Pfam:ANF_receptor	52	395	9.7e-80	PFAM
PBPe	432	801	5.6e-131	SMART
Lig_chan-Glu_bd	442	507	3.81e-34	SMART
Blast:PBPe	809	855	1e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000218441
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000218598
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000218669

Predicted Effect

probably benign
Transcript: ENSMUST00000218823
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000220263
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.1023

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	A	T	1: 25,826,562	Y67N	probably damaging	Het
Akap8l	T	C	17: 32,345,378	T12A	probably damaging	Het
Anapc1	A	G	2: 128,624,916	V1620A	probably benign	Het
Ank2	A	G	3: 126,941,751		probably benign	Het
Ankrd34c	C	T	9: 89,729,761	V176M	possibly damaging	Het
Arhgap39	C	T	15: 76,741,535	D190N	possibly damaging	Het
Cbl	A	G	9: 44,201,119	L93P	probably damaging	Het
Crebl2	C	T	6: 134,851,140	L92F	probably damaging	Het
Dclre1a	A	G	19: 56,541,532	V791A	probably damaging	Het
Dzip1l	T	A	9: 99,639,809		probably null	Het
Echs1	T	C	7: 140,111,812		probably benign	Het
Epha4	A	G	1: 77,506,883	I163T	probably damaging	Het
Fdft1	A	G	14: 63,146,839	S388P	probably damaging	Het
Gbx2	A	G	1: 89,928,715	S318P	probably damaging	Het
Gkn1	T	A	6: 87,346,337	T165S	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Gm5093	T	G	17: 46,439,990	E37A	possibly damaging	Het
Gm527	A	T	12: 64,920,846	N14I	probably damaging	Het
Gm6803	C	T	12: 88,018,596	C59Y	possibly damaging	Het
Gnaz	C	T	10: 74,991,403		probably benign	Het
Gtf2h4	T	C	17: 35,670,381	Y220C	possibly damaging	Het
Igkv8-28	T	C	6: 70,144,157	E2G	probably benign	Het
Itgbl1	T	A	14: 123,972,164	Y318*	probably null	Het
Kcnh5	T	C	12: 74,898,420	E685G	probably benign	Het
Kctd18	A	T	1: 57,962,024		probably benign	Het
Ldhal6b	A	C	17: 5,417,819	V280G	probably damaging	Het
Ldhd	T	C	8: 111,629,071	T182A	probably damaging	Het
Lman2l	T	C	1: 36,424,957	D272G	possibly damaging	Het
Lrrc63	T	C	14: 75,126,464	T76A	probably benign	Het
Map3k3	A	G	11: 106,150,410	T402A	probably benign	Het
Mdga1	C	T	17: 29,850,551	D174N	probably benign	Het
Mob4	A	G	1: 55,148,578	M68V	probably damaging	Het
Olfr344	A	T	2: 36,568,967	Y123F	probably damaging	Het
Rassf8	A	G	6: 145,815,815	E289G	probably benign	Het
Rnf17	T	C	14: 56,465,819		probably null	Het
Rp9	A	G	9: 22,448,664		probably benign	Het
Rrm2b	T	C	15: 37,927,390	Q92R	probably benign	Het
Sema6d	C	T	2: 124,664,947	P879S	probably damaging	Het
Slc27a2	T	A	2: 126,564,738	M114K	probably benign	Het
Slc4a5	T	A	6: 83,271,029	Y521N	probably damaging	Het
Slc6a4	A	T	11: 77,010,511	N24I	probably damaging	Het
Spata13	T	A	14: 60,747,503	D815E	probably benign	Het
Spocd1	A	G	4: 129,954,945	D656G	probably damaging	Het
Susd1	T	A	4: 59,424,108	N39I	probably damaging	Het
Vps13d	G	A	4: 145,168,283	T417I	probably benign	Het
Wdr31	C	T	4: 62,463,400	V65I	probably damaging	Het
Zfp783	T	C	6: 47,948,895		probably benign	Het

Other mutations in Grik2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00863:Grik2	APN	10	49355928	missense	possibly damaging	0.95
IGL00979:Grik2	APN	10	49355938	missense	probably damaging	1.00
IGL01012:Grik2	APN	10	49272956	missense	probably damaging	1.00
IGL01302:Grik2	APN	10	49244330	missense	probably damaging	0.99
IGL01657:Grik2	APN	10	49527986	critical splice donor site	probably null
IGL02162:Grik2	APN	10	49422575	missense	possibly damaging	0.77
IGL02317:Grik2	APN	10	49422615	missense	probably benign	0.16
IGL02512:Grik2	APN	10	49355912	missense	probably benign	0.00
IGL02650:Grik2	APN	10	49101235	missense	probably benign	0.03
IGL03283:Grik2	APN	10	49578269	missense	probably benign	0.00
BB004:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
BB014:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R0325:Grik2	UTSW	10	49240725	missense	probably damaging	1.00
R0492:Grik2	UTSW	10	49101164	missense	probably damaging	0.99
R0601:Grik2	UTSW	10	49422597	missense	probably damaging	1.00
R0844:Grik2	UTSW	10	49101115	missense	possibly damaging	0.81
R1333:Grik2	UTSW	10	49527991	missense	probably damaging	0.98
R1499:Grik2	UTSW	10	49132775	missense	probably damaging	1.00
R1660:Grik2	UTSW	10	49244343	nonsense	probably null
R1721:Grik2	UTSW	10	49523746	missense	possibly damaging	0.93
R1966:Grik2	UTSW	10	49355909	missense	probably damaging	1.00
R1974:Grik2	UTSW	10	49132827	missense	possibly damaging	0.85
R2246:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R3103:Grik2	UTSW	10	49240772	missense	probably damaging	1.00
R3974:Grik2	UTSW	10	49422654	missense	probably damaging	1.00
R4592:Grik2	UTSW	10	49422615	missense	possibly damaging	0.48
R4658:Grik2	UTSW	10	49523792	missense	possibly damaging	0.71
R4748:Grik2	UTSW	10	49535341	missense	possibly damaging	0.87
R4935:Grik2	UTSW	10	49240730	missense	probably damaging	1.00
R4977:Grik2	UTSW	10	49132745	missense	probably damaging	1.00
R5103:Grik2	UTSW	10	49496109	missense	probably benign	0.33
R5330:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5331:Grik2	UTSW	10	49132771	missense	probably damaging	1.00
R5736:Grik2	UTSW	10	49404410	missense	probably damaging	0.96
R5740:Grik2	UTSW	10	49113477	missense	probably damaging	0.99
R6015:Grik2	UTSW	10	49523863	splice site	probably null
R6311:Grik2	UTSW	10	49578138	missense	probably damaging	0.98
R6474:Grik2	UTSW	10	49132680	missense	probably benign
R6504:Grik2	UTSW	10	49356102	missense	probably damaging	1.00
R6591:Grik2	UTSW	10	49272925	nonsense	probably null
R6691:Grik2	UTSW	10	49272925	nonsense	probably null
R6776:Grik2	UTSW	10	49355989	missense	probably damaging	1.00
R7015:Grik2	UTSW	10	49535436	missense	probably damaging	1.00
R7094:Grik2	UTSW	10	49355916	missense	possibly damaging	0.75
R7153:Grik2	UTSW	10	49535367	missense	probably benign	0.00
R7229:Grik2	UTSW	10	49101416	splice site	probably null
R7402:Grik2	UTSW	10	49535397	missense	probably damaging	1.00
R7473:Grik2	UTSW	10	49113522	missense	probably benign	0.22
R7514:Grik2	UTSW	10	49523808	missense	probably damaging	0.99
R7526:Grik2	UTSW	10	49523822	missense	possibly damaging	0.56
R7657:Grik2	UTSW	10	49783151	missense	probably benign	0.11
R7681:Grik2	UTSW	10	49244380	missense	probably damaging	1.00
R7714:Grik2	UTSW	10	49419696	missense	probably damaging	0.97
R7927:Grik2	UTSW	10	49240794	missense	probably damaging	1.00
R7952:Grik2	UTSW	10	49422537	missense	probably benign	0.15
R7979:Grik2	UTSW	10	49404342	missense	probably benign	0.01
R8062:Grik2	UTSW	10	49240767	missense	probably damaging	1.00
R8222:Grik2	UTSW	10	49573648	missense	probably benign	0.29
R8406:Grik2	UTSW	10	49272767	missense	probably damaging	1.00
RF008:Grik2	UTSW	10	49244384	missense	probably damaging	1.00
X0062:Grik2	UTSW	10	49272920	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTGCGTCATTTTCCATCAGC -3'
(R):5'- ATACGGTGCTGGAGGTATCC -3'

Sequencing Primer
(F):5'- CATTGACCACATAATGCTAATAGGAC -3'
(R):5'- TGCTGGAGGTATCCTAACAAAGATC -3'

Posted On

2016-11-21