Incidental Mutation 'R5747:Grik2'
ID445826
Institutional Source Beutler Lab
Gene Symbol Grik2
Ensembl Gene ENSMUSG00000056073
Gene Nameglutamate receptor, ionotropic, kainate 2 (beta 2)
SynonymsGlurbeta2, Glur-6, Glur6
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location49094833-49788766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49523774 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 287 (T287A)
Ref Sequence ENSEMBL: ENSMUSP00000151372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218669] [ENSMUST00000218823] [ENSMUST00000220263]
Predicted Effect probably benign
Transcript: ENSMUST00000079751
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: T287A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105483
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101123
Gene: ENSMUSG00000056073
AA Change: T287A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 298 3e-11 PFAM
Pfam:ANF_receptor 52 334 3.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105484
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: T287A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105485
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: T287A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105486
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: T287A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 3.8e-11 PFAM
Pfam:ANF_receptor 52 395 1.5e-74 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 6e-13 BLAST
low complexity region 875 891 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105487
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: T287A

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000218441
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218598
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000218669
Predicted Effect probably benign
Transcript: ENSMUST00000218823
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000220263
AA Change: T287A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Grik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Grik2 APN 10 49355928 missense possibly damaging 0.95
IGL00979:Grik2 APN 10 49355938 missense probably damaging 1.00
IGL01012:Grik2 APN 10 49272956 missense probably damaging 1.00
IGL01302:Grik2 APN 10 49244330 missense probably damaging 0.99
IGL01657:Grik2 APN 10 49527986 critical splice donor site probably null
IGL02162:Grik2 APN 10 49422575 missense possibly damaging 0.77
IGL02317:Grik2 APN 10 49422615 missense probably benign 0.16
IGL02512:Grik2 APN 10 49355912 missense probably benign 0.00
IGL02650:Grik2 APN 10 49101235 missense probably benign 0.03
IGL03283:Grik2 APN 10 49578269 missense probably benign 0.00
R0325:Grik2 UTSW 10 49240725 missense probably damaging 1.00
R0492:Grik2 UTSW 10 49101164 missense probably damaging 0.99
R0601:Grik2 UTSW 10 49422597 missense probably damaging 1.00
R0844:Grik2 UTSW 10 49101115 missense possibly damaging 0.81
R1333:Grik2 UTSW 10 49527991 missense probably damaging 0.98
R1499:Grik2 UTSW 10 49132775 missense probably damaging 1.00
R1660:Grik2 UTSW 10 49244343 nonsense probably null
R1721:Grik2 UTSW 10 49523746 missense possibly damaging 0.93
R1966:Grik2 UTSW 10 49355909 missense probably damaging 1.00
R1974:Grik2 UTSW 10 49132827 missense possibly damaging 0.85
R2246:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R3103:Grik2 UTSW 10 49240772 missense probably damaging 1.00
R3974:Grik2 UTSW 10 49422654 missense probably damaging 1.00
R4592:Grik2 UTSW 10 49422615 missense possibly damaging 0.48
R4658:Grik2 UTSW 10 49523792 missense possibly damaging 0.71
R4748:Grik2 UTSW 10 49535341 missense possibly damaging 0.87
R4935:Grik2 UTSW 10 49240730 missense probably damaging 1.00
R4977:Grik2 UTSW 10 49132745 missense probably damaging 1.00
R5103:Grik2 UTSW 10 49496109 missense probably benign 0.33
R5330:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5331:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5736:Grik2 UTSW 10 49404410 missense probably damaging 0.96
R5740:Grik2 UTSW 10 49113477 missense probably damaging 0.99
R6015:Grik2 UTSW 10 49523863 splice site probably null
R6311:Grik2 UTSW 10 49578138 missense probably damaging 0.98
R6474:Grik2 UTSW 10 49132680 missense probably benign
R6504:Grik2 UTSW 10 49356102 missense probably damaging 1.00
R6591:Grik2 UTSW 10 49272925 nonsense probably null
R6691:Grik2 UTSW 10 49272925 nonsense probably null
R6776:Grik2 UTSW 10 49355989 missense probably damaging 1.00
R7015:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R7094:Grik2 UTSW 10 49355916 missense possibly damaging 0.75
R7153:Grik2 UTSW 10 49535367 missense probably benign 0.00
R7229:Grik2 UTSW 10 49101416 intron probably null
R7402:Grik2 UTSW 10 49535397 missense probably damaging 1.00
R7473:Grik2 UTSW 10 49113522 missense probably benign 0.22
R7514:Grik2 UTSW 10 49523808 missense probably damaging 0.99
R7526:Grik2 UTSW 10 49523822 missense possibly damaging 0.56
X0062:Grik2 UTSW 10 49272920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGCGTCATTTTCCATCAGC -3'
(R):5'- ATACGGTGCTGGAGGTATCC -3'

Sequencing Primer
(F):5'- CATTGACCACATAATGCTAATAGGAC -3'
(R):5'- TGCTGGAGGTATCCTAACAAAGATC -3'
Posted On2016-11-21