Incidental Mutation 'R5747:Lrrc63'
ID445837
Institutional Source Beutler Lab
Gene Symbol Lrrc63
Ensembl Gene ENSMUSG00000021997
Gene Nameleucine rich repeat containing 63
Synonyms4921509B22Rik
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75084303-75130881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75126464 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 76 (T76A)
Ref Sequence ENSEMBL: ENSMUSP00000022574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022574] [ENSMUST00000134114] [ENSMUST00000143539]
Predicted Effect probably benign
Transcript: ENSMUST00000022574
AA Change: T76A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022574
Gene: ENSMUSG00000021997
AA Change: T76A

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 276 310 N/A INTRINSIC
LRR 412 434 2.82e0 SMART
LRR 435 458 1.45e1 SMART
LRR 481 504 1.53e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124608
Predicted Effect probably benign
Transcript: ENSMUST00000134114
SMART Domains Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143539
SMART Domains Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 76 4.45e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Lrrc63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Lrrc63 APN 14 75084982 missense possibly damaging 0.73
IGL02222:Lrrc63 APN 14 75086140 missense probably damaging 0.99
IGL02385:Lrrc63 APN 14 75086200 missense probably benign
FR4548:Lrrc63 UTSW 14 75125182 small deletion probably benign
FR4589:Lrrc63 UTSW 14 75125182 small deletion probably benign
R0398:Lrrc63 UTSW 14 75126470 missense probably benign 0.06
R0637:Lrrc63 UTSW 14 75098220 splice site probably benign
R0669:Lrrc63 UTSW 14 75126110 missense probably benign 0.27
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1465:Lrrc63 UTSW 14 75107389 missense possibly damaging 0.92
R1478:Lrrc63 UTSW 14 75125984 missense probably benign
R1591:Lrrc63 UTSW 14 75125892 missense possibly damaging 0.92
R1753:Lrrc63 UTSW 14 75086344 splice site probably null
R3713:Lrrc63 UTSW 14 75107336 missense probably benign 0.12
R4013:Lrrc63 UTSW 14 75098291 missense probably damaging 0.98
R4793:Lrrc63 UTSW 14 75126161 missense possibly damaging 0.93
R4888:Lrrc63 UTSW 14 75125966 missense probably benign
R4937:Lrrc63 UTSW 14 75084949 missense probably damaging 0.99
R5197:Lrrc63 UTSW 14 75084882 missense possibly damaging 0.68
R5861:Lrrc63 UTSW 14 75107366 missense possibly damaging 0.83
R5905:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6028:Lrrc63 UTSW 14 75086174 missense possibly damaging 0.92
R6661:Lrrc63 UTSW 14 75125193 missense unknown
R6982:Lrrc63 UTSW 14 75084771 missense probably benign 0.33
R7062:Lrrc63 UTSW 14 75086297 missense probably benign 0.00
R7439:Lrrc63 UTSW 14 75126257 missense possibly damaging 0.84
R7440:Lrrc63 UTSW 14 75121013 missense possibly damaging 0.91
R7441:Lrrc63 UTSW 14 75126257 missense possibly damaging 0.84
R7474:Lrrc63 UTSW 14 75126203 missense possibly damaging 0.83
R7604:Lrrc63 UTSW 14 75084969 missense possibly damaging 0.68
R7703:Lrrc63 UTSW 14 75123007 missense possibly damaging 0.91
Z1088:Lrrc63 UTSW 14 75125990 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAGTGAGATACCCATCTTCTTTGAC -3'
(R):5'- AGCAGCTTTGTTTGGAGAGC -3'

Sequencing Primer
(F):5'- TTTCGAGGACTTCTTGGCTC -3'
(R):5'- GAGGAGACCTATGGAAAGTTC -3'
Posted On2016-11-21