Incidental Mutation 'R5747:Rrm2b'
ID445839
Institutional Source Beutler Lab
Gene Symbol Rrm2b
Ensembl Gene ENSMUSG00000022292
Gene Nameribonucleotide reductase M2 B (TP53 inducible)
Synonymsp53R2
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37923952-37961318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37927390 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 92 (Q92R)
Ref Sequence ENSEMBL: ENSMUSP00000123691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022901] [ENSMUST00000137636] [ENSMUST00000144498] [ENSMUST00000146821] [ENSMUST00000153481]
Predicted Effect probably benign
Transcript: ENSMUST00000022901
AA Change: Q304R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022901
Gene: ENSMUSG00000022292
AA Change: Q304R

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 41 308 4.2e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137636
AA Change: Q252R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119400
Gene: ENSMUSG00000022292
AA Change: Q252R

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 6 261 1.7e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144498
SMART Domains Protein: ENSMUSP00000121069
Gene: ENSMUSG00000022292

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 32 111 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146821
AA Change: Q92R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123691
Gene: ENSMUSG00000022292
AA Change: Q92R

DomainStartEndE-ValueType
Pfam:Ribonuc_red_sm 13 101 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153481
Meta Mutation Damage Score 0.0611 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the small subunit of a p53-inducible ribonucleotide reductase. This heterotetrameric enzyme catalyzes the conversion of ribonucleoside diphosphates to deoxyribonucleoside diphosphates. The product of this reaction is necessary for DNA synthesis. Mutations in this gene have been associated with autosomal recessive mitochondrial DNA depletion syndrome, autosomal dominant progressive external ophthalmoplegia-5, and mitochondrial neurogastrointestinal encephalopathy. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
PHENOTYPE: Loss of both functional copies of this gene results in growth retardation, multiple organ failure, and ultimately premature death due to kidney failure. Spontaneous mutation rates and apoptosis are increased in the kidneys due to an attenuation of dNTP pools and a resulting impairment of DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Rrm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Rrm2b APN 15 37929075 missense probably damaging 1.00
IGL00806:Rrm2b APN 15 37931622 missense probably benign 0.02
IGL01145:Rrm2b APN 15 37944560 missense probably damaging 0.96
PIT4515001:Rrm2b UTSW 15 37946804 missense probably benign
R0026:Rrm2b UTSW 15 37953741 missense probably benign 0.19
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0044:Rrm2b UTSW 15 37953688 missense possibly damaging 0.83
R0624:Rrm2b UTSW 15 37931645 missense probably benign 0.00
R1371:Rrm2b UTSW 15 37946809 missense probably benign 0.06
R1635:Rrm2b UTSW 15 37945084 missense probably damaging 1.00
R1692:Rrm2b UTSW 15 37927322 nonsense probably null
R1710:Rrm2b UTSW 15 37929096 missense probably damaging 1.00
R2273:Rrm2b UTSW 15 37945051 missense possibly damaging 0.92
R3196:Rrm2b UTSW 15 37945147 unclassified probably null
R4459:Rrm2b UTSW 15 37945153 splice site probably null
R5310:Rrm2b UTSW 15 37927327 missense probably damaging 1.00
R7343:Rrm2b UTSW 15 37944573 missense probably benign 0.18
R7378:Rrm2b UTSW 15 37931647 missense probably benign
R7539:Rrm2b UTSW 15 37937351 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCAACAACAGGTTTCCATGTG -3'
(R):5'- TGGGAACAGCCATCAGAAAC -3'

Sequencing Primer
(F):5'- TCCTCTGAGGACTGGACTAAG -3'
(R):5'- ACCCTCAGTACCTTAGTGGAG -3'
Posted On2016-11-21