Mutagenetix > Incidental Mutations

Incidental Mutation 'R5747:Arhgap39'

445840

Institutional Source

Beutler Lab

Gene Symbol

Arhgap39

Ensembl Gene

ENSMUSG00000033697

Gene Name

Rho GTPase activating protein 39

Synonyms

D15Wsu169e

MMRRC Submission

043354-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.199) question?

Stock #

R5747 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76723985-76818170 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 76741535 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 190 (D190N)

Ref Sequence

ENSEMBL: ENSMUSP00000036697 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036176] [ENSMUST00000077821]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036176
AA Change: D190N

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000036697
Gene: ENSMUSG00000033697
AA Change: D190N

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	759	904	2.3e-32	PFAM
RhoGAP	932	1105	5.9e-28	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077821
AA Change: D190N

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000076993
Gene: ENSMUSG00000033697
AA Change: D190N

Domain	Start	End	E-Value	Type
WW	27	60	1.64e0	SMART
WW	66	99	5.41e-1	SMART
low complexity region	125	138	N/A	INTRINSIC
low complexity region	304	318	N/A	INTRINSIC
Pfam:MyTH4	756	874	3.3e-25	PFAM
RhoGAP	901	1074	5.9e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177011

Meta Mutation Damage Score

0.1701

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

100% (54/54)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	A	T	1: 25,826,562	Y67N	probably damaging	Het
Akap8l	T	C	17: 32,345,378	T12A	probably damaging	Het
Anapc1	A	G	2: 128,624,916	V1620A	probably benign	Het
Ank2	A	G	3: 126,941,751		probably benign	Het
Ankrd34c	C	T	9: 89,729,761	V176M	possibly damaging	Het
Cbl	A	G	9: 44,201,119	L93P	probably damaging	Het
Crebl2	C	T	6: 134,851,140	L92F	probably damaging	Het
Dclre1a	A	G	19: 56,541,532	V791A	probably damaging	Het
Dzip1l	T	A	9: 99,639,809		probably null	Het
Echs1	T	C	7: 140,111,812		probably benign	Het
Epha4	A	G	1: 77,506,883	I163T	probably damaging	Het
Fdft1	A	G	14: 63,146,839	S388P	probably damaging	Het
Gbx2	A	G	1: 89,928,715	S318P	probably damaging	Het
Gkn1	T	A	6: 87,346,337	T165S	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10801	G	C	2: 98,664,007	R143T	possibly damaging	Het
Gm5093	T	G	17: 46,439,990	E37A	possibly damaging	Het
Gm527	A	T	12: 64,920,846	N14I	probably damaging	Het
Gm6803	C	T	12: 88,018,596	C59Y	possibly damaging	Het
Gnaz	C	T	10: 74,991,403		probably benign	Het
Grik2	T	C	10: 49,523,774	T287A	probably benign	Het
Gtf2h4	T	C	17: 35,670,381	Y220C	possibly damaging	Het
Igkv8-28	T	C	6: 70,144,157	E2G	probably benign	Het
Itgbl1	T	A	14: 123,972,164	Y318*	probably null	Het
Kcnh5	T	C	12: 74,898,420	E685G	probably benign	Het
Kctd18	A	T	1: 57,962,024		probably benign	Het
Ldhal6b	A	C	17: 5,417,819	V280G	probably damaging	Het
Ldhd	T	C	8: 111,629,071	T182A	probably damaging	Het
Lman2l	T	C	1: 36,424,957	D272G	possibly damaging	Het
Lrrc63	T	C	14: 75,126,464	T76A	probably benign	Het
Map3k3	A	G	11: 106,150,410	T402A	probably benign	Het
Mdga1	C	T	17: 29,850,551	D174N	probably benign	Het
Mob4	A	G	1: 55,148,578	M68V	probably damaging	Het
Olfr344	A	T	2: 36,568,967	Y123F	probably damaging	Het
Rassf8	A	G	6: 145,815,815	E289G	probably benign	Het
Rnf17	T	C	14: 56,465,819		probably null	Het
Rp9	A	G	9: 22,448,664		probably benign	Het
Rrm2b	T	C	15: 37,927,390	Q92R	probably benign	Het
Sema6d	C	T	2: 124,664,947	P879S	probably damaging	Het
Slc27a2	T	A	2: 126,564,738	M114K	probably benign	Het
Slc4a5	T	A	6: 83,271,029	Y521N	probably damaging	Het
Slc6a4	A	T	11: 77,010,511	N24I	probably damaging	Het
Spata13	T	A	14: 60,747,503	D815E	probably benign	Het
Spocd1	A	G	4: 129,954,945	D656G	probably damaging	Het
Susd1	T	A	4: 59,424,108	N39I	probably damaging	Het
Vps13d	G	A	4: 145,168,283	T417I	probably benign	Het
Wdr31	C	T	4: 62,463,400	V65I	probably damaging	Het
Zfp783	T	C	6: 47,948,895		probably benign	Het

Other mutations in Arhgap39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01547:Arhgap39	APN	15	76737815	splice site	probably benign
IGL01586:Arhgap39	APN	15	76730438	missense	probably benign	0.16
IGL01693:Arhgap39	APN	15	76725967	missense	probably null	1.00
IGL02017:Arhgap39	APN	15	76737037	missense	probably damaging	0.98
IGL02508:Arhgap39	APN	15	76724984	makesense	probably null
IGL03333:Arhgap39	APN	15	76726732	missense	probably benign	0.05
R0328:Arhgap39	UTSW	15	76751952	splice site	probably benign
R0432:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0479:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0549:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R0551:Arhgap39	UTSW	15	76734886	missense	probably damaging	0.99
R1054:Arhgap39	UTSW	15	76751559	missense	probably benign
R1830:Arhgap39	UTSW	15	76735183	missense	probably damaging	1.00
R2421:Arhgap39	UTSW	15	76725146	missense	probably damaging	1.00
R2497:Arhgap39	UTSW	15	76725385	missense	probably damaging	1.00
R3909:Arhgap39	UTSW	15	76751888	missense	probably benign	0.03
R4410:Arhgap39	UTSW	15	76725512	unclassified	probably benign
R4626:Arhgap39	UTSW	15	76737637	missense	possibly damaging	0.92
R4790:Arhgap39	UTSW	15	76726731	missense	possibly damaging	0.51
R4792:Arhgap39	UTSW	15	76741517	missense	possibly damaging	0.92
R4911:Arhgap39	UTSW	15	76737805	missense	probably damaging	1.00
R5225:Arhgap39	UTSW	15	76725515	unclassified	probably benign
R5417:Arhgap39	UTSW	15	76735101	missense	possibly damaging	0.80
R5443:Arhgap39	UTSW	15	76797925	intron	probably benign
R5521:Arhgap39	UTSW	15	76765494	missense	possibly damaging	0.66
R5686:Arhgap39	UTSW	15	76726633	missense	probably damaging	1.00
R5785:Arhgap39	UTSW	15	76737418	missense	probably benign
R5879:Arhgap39	UTSW	15	76751807	missense	probably damaging	1.00
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6035:Arhgap39	UTSW	15	76737224	nonsense	probably null
R6049:Arhgap39	UTSW	15	76727401	critical splice donor site	probably null
R6143:Arhgap39	UTSW	15	76730406	nonsense	probably null
R6232:Arhgap39	UTSW	15	76736512	missense	probably damaging	1.00
R6276:Arhgap39	UTSW	15	76737536	missense	probably benign	0.06
R6277:Arhgap39	UTSW	15	76735137	missense	probably damaging	1.00
R6305:Arhgap39	UTSW	15	76737702	missense	probably benign	0.31
R6587:Arhgap39	UTSW	15	76737499	missense	probably damaging	1.00
R7153:Arhgap39	UTSW	15	76765491	missense	probably benign	0.09
R7447:Arhgap39	UTSW	15	76765597	start gained	probably benign
R7658:Arhgap39	UTSW	15	76737417	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTTCCTCCAGAAGCTGATAGG -3'
(R):5'- CATAAGAAGTGCAACCCAGGTC -3'

Sequencing Primer
(F):5'- TGATAGGAGCCACACGACTCTTC -3'
(R):5'- GTGCAACCCAGGTCATCCC -3'

Posted On

2016-11-21