Incidental Mutation 'R5747:Gtf2h4'
ID445845
Institutional Source Beutler Lab
Gene Symbol Gtf2h4
Ensembl Gene ENSMUSG00000001524
Gene Namegeneral transcription factor II H, polypeptide 4
Synonymsp52
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35667730-35673739 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35670381 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 220 (Y220C)
Ref Sequence ENSEMBL: ENSMUSP00000124335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000159852] [ENSMUST00000160039] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000162266] [ENSMUST00000165144]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001565
AA Change: Y220C

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524
AA Change: Y220C

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000043674
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159671
Predicted Effect probably benign
Transcript: ENSMUST00000159852
SMART Domains Protein: ENSMUSP00000124060
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 61 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160039
SMART Domains Protein: ENSMUSP00000124683
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 164 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160711
Predicted Effect possibly damaging
Transcript: ENSMUST00000160734
AA Change: Y220C

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524
AA Change: Y220C

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160752
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162266
SMART Domains Protein: ENSMUSP00000124103
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 91 1.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162927
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164978
Predicted Effect probably benign
Transcript: ENSMUST00000165144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171536
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a subunit of the general transcription factor multiprotein complex that plays roles in basal transcription, DNA repair and cell cycle control. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5093 T G 17: 46,439,990 E37A possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Gtf2h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Gtf2h4 APN 17 35669982 missense probably damaging 1.00
IGL03412:Gtf2h4 APN 17 35668483 missense probably damaging 0.98
miramont UTSW 17 32345378 missense probably damaging 0.97
R0112:Gtf2h4 UTSW 17 35670448 missense possibly damaging 0.93
R0554:Gtf2h4 UTSW 17 35668639 missense probably benign 0.06
R0928:Gtf2h4 UTSW 17 35670885 missense probably damaging 1.00
R1917:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R1918:Gtf2h4 UTSW 17 35670198 missense possibly damaging 0.59
R2264:Gtf2h4 UTSW 17 35668664 unclassified probably benign
R2287:Gtf2h4 UTSW 17 35671225 critical splice donor site probably null
R2357:Gtf2h4 UTSW 17 35667999 missense probably damaging 1.00
R2519:Gtf2h4 UTSW 17 35670909 missense probably damaging 1.00
R4021:Gtf2h4 UTSW 17 35670664 missense probably benign 0.35
R4881:Gtf2h4 UTSW 17 35670233 missense possibly damaging 0.94
R5889:Gtf2h4 UTSW 17 35670900 missense possibly damaging 0.51
R6356:Gtf2h4 UTSW 17 35669755 missense probably damaging 0.99
R7323:Gtf2h4 UTSW 17 35669965 missense probably damaging 0.99
R7426:Gtf2h4 UTSW 17 35669358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACTGACCTTGCCAAGAGTG -3'
(R):5'- CAGGCCGGGCTTATGAAAAG -3'

Sequencing Primer
(F):5'- GTGGAGAAGCTGAGCTGG -3'
(R):5'- CTCCTTGGGTCTCATATAAAATGGG -3'
Posted On2016-11-21