Incidental Mutation 'R5747:Gm5093'
ID445846
Institutional Source Beutler Lab
Gene Symbol Gm5093
Ensembl Gene ENSMUSG00000091742
Gene Namepredicted gene 5093
Synonyms
MMRRC Submission 043354-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R5747 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46439578-46440099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 46439990 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 37 (E37A)
Ref Sequence ENSEMBL: ENSMUSP00000127966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000087012] [ENSMUST00000166852]
Predicted Effect probably benign
Transcript: ENSMUST00000047034
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087012
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000166852
AA Change: E37A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127966
Gene: ENSMUSG00000091742
AA Change: E37A

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 59 4.1e-18 PFAM
Pfam:Ribosomal_L5_C 63 161 8.7e-25 PFAM
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,826,562 Y67N probably damaging Het
Akap8l T C 17: 32,345,378 T12A probably damaging Het
Anapc1 A G 2: 128,624,916 V1620A probably benign Het
Ank2 A G 3: 126,941,751 probably benign Het
Ankrd34c C T 9: 89,729,761 V176M possibly damaging Het
Arhgap39 C T 15: 76,741,535 D190N possibly damaging Het
Cbl A G 9: 44,201,119 L93P probably damaging Het
Crebl2 C T 6: 134,851,140 L92F probably damaging Het
Dclre1a A G 19: 56,541,532 V791A probably damaging Het
Dzip1l T A 9: 99,639,809 probably null Het
Echs1 T C 7: 140,111,812 probably benign Het
Epha4 A G 1: 77,506,883 I163T probably damaging Het
Fdft1 A G 14: 63,146,839 S388P probably damaging Het
Gbx2 A G 1: 89,928,715 S318P probably damaging Het
Gkn1 T A 6: 87,346,337 T165S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm527 A T 12: 64,920,846 N14I probably damaging Het
Gm6803 C T 12: 88,018,596 C59Y possibly damaging Het
Gnaz C T 10: 74,991,403 probably benign Het
Grik2 T C 10: 49,523,774 T287A probably benign Het
Gtf2h4 T C 17: 35,670,381 Y220C possibly damaging Het
Igkv8-28 T C 6: 70,144,157 E2G probably benign Het
Itgbl1 T A 14: 123,972,164 Y318* probably null Het
Kcnh5 T C 12: 74,898,420 E685G probably benign Het
Kctd18 A T 1: 57,962,024 probably benign Het
Ldhal6b A C 17: 5,417,819 V280G probably damaging Het
Ldhd T C 8: 111,629,071 T182A probably damaging Het
Lman2l T C 1: 36,424,957 D272G possibly damaging Het
Lrrc63 T C 14: 75,126,464 T76A probably benign Het
Map3k3 A G 11: 106,150,410 T402A probably benign Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Mob4 A G 1: 55,148,578 M68V probably damaging Het
Olfr344 A T 2: 36,568,967 Y123F probably damaging Het
Rassf8 A G 6: 145,815,815 E289G probably benign Het
Rnf17 T C 14: 56,465,819 probably null Het
Rp9 A G 9: 22,448,664 probably benign Het
Rrm2b T C 15: 37,927,390 Q92R probably benign Het
Sema6d C T 2: 124,664,947 P879S probably damaging Het
Slc27a2 T A 2: 126,564,738 M114K probably benign Het
Slc4a5 T A 6: 83,271,029 Y521N probably damaging Het
Slc6a4 A T 11: 77,010,511 N24I probably damaging Het
Spata13 T A 14: 60,747,503 D815E probably benign Het
Spocd1 A G 4: 129,954,945 D656G probably damaging Het
Susd1 T A 4: 59,424,108 N39I probably damaging Het
Vps13d G A 4: 145,168,283 T417I probably benign Het
Wdr31 C T 4: 62,463,400 V65I probably damaging Het
Zfp783 T C 6: 47,948,895 probably benign Het
Other mutations in Gm5093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03383:Gm5093 APN 17 46439591 missense probably benign 0.32
R0690:Gm5093 UTSW 17 46439738 missense possibly damaging 0.53
R1436:Gm5093 UTSW 17 46439754 missense probably damaging 1.00
R1453:Gm5093 UTSW 17 46439696 missense probably benign 0.02
R5187:Gm5093 UTSW 17 46439873 missense possibly damaging 0.82
R6182:Gm5093 UTSW 17 46439642 missense probably benign 0.05
R7216:Gm5093 UTSW 17 46440088 missense not run
R7456:Gm5093 UTSW 17 46439753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCAAAGTTTCCAGTATCCGAG -3'
(R):5'- ATGTGCACTCTTCCTGAGCAG -3'

Sequencing Primer
(F):5'- CCAGTATCCGAGAAGTTATTTTTCC -3'
(R):5'- AGGTGACCATTCTCTGCAAG -3'
Posted On2016-11-21