Incidental Mutation 'R0029:Axin2'
ID44585
Institutional Source Beutler Lab
Gene Symbol Axin2
Ensembl Gene ENSMUSG00000000142
Gene Nameaxin 2
SynonymsAxil, Conductin
MMRRC Submission 038323-MU
Accession Numbers

Genbank: NM_015732; MGI: 1270862

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0029 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location108920349-108950783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108924047 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 254 (T254A)
Ref Sequence ENSEMBL: ENSMUSP00000102322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052915] [ENSMUST00000106711] [ENSMUST00000140821] [ENSMUST00000144511] [ENSMUST00000152909]
Predicted Effect probably benign
Transcript: ENSMUST00000052915
AA Change: T254A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051331
Gene: ENSMUSG00000000142
AA Change: T254A

DomainStartEndE-ValueType
Pfam:AXIN1_TNKS_BD 9 73 8.1e-27 PFAM
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 472 7.6e-13 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 758 840 1.42e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106711
AA Change: T254A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000102322
Gene: ENSMUSG00000000142
AA Change: T254A

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
RGS 81 200 4.7e-33 SMART
low complexity region 302 318 N/A INTRINSIC
coiled coil region 377 405 N/A INTRINSIC
Pfam:Axin_b-cat_bind 432 469 8.6e-22 PFAM
low complexity region 511 520 N/A INTRINSIC
DAX 693 775 1.42e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140821
SMART Domains Protein: ENSMUSP00000120664
Gene: ENSMUSG00000000142

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
PDB:1DK8|A 67 99 1e-7 PDB
SCOP:d1dk8a_ 67 99 7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144511
SMART Domains Protein: ENSMUSP00000119915
Gene: ENSMUSG00000000142

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152909
SMART Domains Protein: ENSMUSP00000116956
Gene: ENSMUSG00000000142

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
PDB:1DK8|A 67 102 1e-8 PDB
SCOP:d1dk8a_ 67 102 8e-8 SMART
Blast:RGS 81 103 2e-8 BLAST
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit premature fusion of cranial sutures, enhanced expansion of osteoprogenitors, accelerated ossification, and increased osteoblast proliferation and differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gapvd1 T A 2: 34,678,141 I1404F probably damaging Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Impg1 T C 9: 80,398,371 D138G probably damaging Het
Itga2 G A 13: 114,870,496 S432L possibly damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lipm T C 19: 34,116,548 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc26a2 G A 18: 61,202,310 P24S possibly damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Tmem63a A G 1: 180,962,466 Y401C probably benign Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Axin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Axin2 APN 11 108923990 missense probably benign
IGL01094:Axin2 APN 11 108923675 missense probably damaging 0.99
IGL01563:Axin2 APN 11 108923805 missense probably damaging 0.97
IGL02088:Axin2 APN 11 108923616 missense probably damaging 1.00
IGL02724:Axin2 APN 11 108942946 missense possibly damaging 0.48
PIT4131001:Axin2 UTSW 11 108924003 missense possibly damaging 0.85
R0052:Axin2 UTSW 11 108949270 missense probably damaging 1.00
R0112:Axin2 UTSW 11 108939397 missense possibly damaging 0.62
R0372:Axin2 UTSW 11 108923333 missense probably damaging 1.00
R0372:Axin2 UTSW 11 108924110 unclassified probably benign
R1200:Axin2 UTSW 11 108931550 missense probably damaging 0.98
R1924:Axin2 UTSW 11 108942968 missense probably benign 0.02
R2025:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R2427:Axin2 UTSW 11 108923974 missense possibly damaging 0.93
R4210:Axin2 UTSW 11 108942576 missense possibly damaging 0.89
R4781:Axin2 UTSW 11 108943856 missense probably damaging 1.00
R4846:Axin2 UTSW 11 108942299 missense probably benign 0.00
R4956:Axin2 UTSW 11 108943078 missense probably damaging 1.00
R7365:Axin2 UTSW 11 108939376 missense possibly damaging 0.93
R7519:Axin2 UTSW 11 108942246 missense probably benign 0.00
R7662:Axin2 UTSW 11 108942456 missense possibly damaging 0.96
X0054:Axin2 UTSW 11 108923574 missense probably damaging 1.00
Z1177:Axin2 UTSW 11 108923474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGATGGAGGAAAATGCCTACC -3'
(R):5'- AGCTATGTCTGCATTGCAACTCCC -3'

Sequencing Primer
(F):5'- GAAAATGCCTACCAGGTGTTC -3'
(R):5'- CATGAGATCAAAGGGTTCCTAGC -3'
Posted On2013-06-11