Mutagenetix > Incidental Mutation

Incidental Mutation 'R5748:Invs'

445860

Institutional Source

Beutler Lab

Gene Symbol

Invs

Ensembl Gene

ENSMUSG00000028344

Gene Name

inversin

Synonyms

MMRRC Submission

043355-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.690) question?

Stock #

R5748 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48279760-48431954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 48307823 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 83 (T83A)

Ref Sequence

ENSEMBL: ENSMUSP00000030029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000030029
AA Change: T83A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: T83A

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	148	177	6.46e-4	SMART
ANK	181	215	3.44e1	SMART
ANK	220	250	1.11e-2	SMART
ANK	254	285	2.07e-2	SMART
ANK	288	317	3.18e-3	SMART
ANK	321	350	3.91e-3	SMART
ANK	356	385	2.28e-4	SMART
ANK	389	418	8.39e-3	SMART
ANK	422	451	3.76e-5	SMART
ANK	455	484	2.45e-4	SMART
ANK	488	517	1.31e-4	SMART
ANK	523	553	6.71e-2	SMART
IQ	554	576	5.75e-2	SMART
low complexity region	589	607	N/A	INTRINSIC
IQ	913	935	2.46e-1	SMART
low complexity region	973	989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143433
AA Change: T83A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: T83A

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	164	194	1.11e-2	SMART
ANK	198	229	2.07e-2	SMART
ANK	232	261	3.18e-3	SMART
ANK	265	294	3.91e-3	SMART
ANK	300	329	2.28e-4	SMART
ANK	333	362	8.39e-3	SMART
ANK	366	395	3.76e-5	SMART
ANK	399	428	2.45e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156602

Meta Mutation Damage Score

0.3958

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,089,699	Q285R	probably damaging	Het
Acy1	T	A	9: 106,436,727	N78I	probably damaging	Het
Anln	T	C	9: 22,337,934	K166E	probably damaging	Het
C1qtnf4	A	G	2: 90,889,533	D50G	probably damaging	Het
Cntnap2	A	G	6: 45,715,884	T100A	probably damaging	Het
Cxcr6	C	T	9: 123,810,341	R143C	probably damaging	Het
Dhx16	T	C	17: 35,883,314	L439P	probably damaging	Het
Dlk1	T	C	12: 109,459,972	V257A	probably benign	Het
Ebpl	A	T	14: 61,360,344	L16Q	probably null	Het
Eml5	T	A	12: 98,825,555	Y1234F	probably damaging	Het
Fam129b	A	T	2: 32,919,569	K260M	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gria1	A	G	11: 57,309,876	D793G	probably benign	Het
Gtse1	T	C	15: 85,867,577	Y324H	probably benign	Het
Hcn1	A	T	13: 117,976,055	S852C	probably damaging	Het
Iqgap3	T	C	3: 88,109,370	L155P	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc14b	T	A	13: 74,363,640	D107V	probably damaging	Het
Mcm9	A	T	10: 53,625,729	H253Q	probably damaging	Het
Mcmdc2	A	G	1: 9,911,807	Y30C	probably damaging	Het
Mdga1	C	T	17: 29,850,551	D174N	probably benign	Het
Med13l	G	A	5: 118,593,445	R62H	probably damaging	Het
Mrgpra2b	A	G	7: 47,502,532		probably benign	Het
Nacad	T	A	11: 6,598,370	K1426*	probably null	Het
Ndufb6	A	G	4: 40,279,234	L35S	probably damaging	Het
Nkapl	A	G	13: 21,467,609	I278T	probably benign	Het
Nrbp2	T	C	15: 76,089,483	E263G	probably damaging	Het
Nup85	T	A	11: 115,580,512	L110Q	probably damaging	Het
Olfr1251	A	T	2: 89,667,802	M28K	possibly damaging	Het
Olfr1415	T	A	1: 92,491,093	I221F	probably damaging	Het
Olfr1448	T	A	19: 12,920,015	Q98L	probably damaging	Het
Olfr293	A	G	7: 86,664,085	N141S	possibly damaging	Het
Olfr395	A	G	11: 73,906,895	I199T	probably damaging	Het
Olfr720	T	C	14: 14,175,314	Y256C	probably damaging	Het
Polr2m	C	T	9: 71,483,636	D95N	probably benign	Het
Popdc2	A	T	16: 38,374,303	D362V	probably damaging	Het
Pot1a	A	T	6: 25,758,856	I308N	possibly damaging	Het
Rsf1	GCGGCGGC	GCGGCGGCGTCGGCGGC	7: 97,579,928		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rundc3a	G	A	11: 102,399,399	E189K	possibly damaging	Het
Scaf1	A	C	7: 45,012,806		probably null	Het
Scaper	T	C	9: 55,859,076		probably null	Het
Sh3glb1	C	T	3: 144,712,649	C51Y	probably damaging	Het
Slc10a5	T	C	3: 10,335,331	T90A	probably benign	Het
Slc17a3	T	A	13: 23,856,466	S336T	probably damaging	Het
Slc41a2	C	A	10: 83,297,159	C341F	probably benign	Het
Spata31	A	G	13: 64,920,313	*67W	probably null	Het
Stap2	C	T	17: 56,000,475		probably null	Het
Stt3a	A	T	9: 36,752,400	M182K	probably benign	Het
Tcfl5	G	A	2: 180,642,257		silent	Het
Tmx3	T	C	18: 90,537,101	V314A	probably benign	Het
Upf1	A	G	8: 70,338,517	L525P	probably damaging	Het
Wdr6	T	C	9: 108,575,782	I301V	possibly damaging	Het
Ylpm1	T	A	12: 85,060,251		probably null	Het
Zfp273	T	C	13: 67,825,331	Y160H	probably damaging	Het

Other mutations in Invs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Invs	APN	4	48402909	missense	probably damaging	0.98
IGL00487:Invs	APN	4	48407689	nonsense	probably null
IGL01487:Invs	APN	4	48398136	missense	probably benign	0.26
IGL01696:Invs	APN	4	48425997	missense	probably damaging	1.00
IGL02238:Invs	APN	4	48390029	missense	probably damaging	1.00
IGL03286:Invs	APN	4	48382261	missense	probably benign	0.26
R0645:Invs	UTSW	4	48407653	missense	probably benign	0.00
R0661:Invs	UTSW	4	48421861	missense	probably benign
R0698:Invs	UTSW	4	48396364	missense	probably benign	0.04
R0763:Invs	UTSW	4	48392628	missense	possibly damaging	0.82
R1183:Invs	UTSW	4	48421725	missense	possibly damaging	0.68
R1381:Invs	UTSW	4	48421942	nonsense	probably null
R1511:Invs	UTSW	4	48382148	missense	possibly damaging	0.82
R1843:Invs	UTSW	4	48422035	missense	probably damaging	0.96
R1903:Invs	UTSW	4	48402824	splice site	probably null
R1928:Invs	UTSW	4	48390095	missense	probably damaging	1.00
R1990:Invs	UTSW	4	48392599	missense	possibly damaging	0.88
R2063:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2064:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2065:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2066:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R4744:Invs	UTSW	4	48397609	missense	probably damaging	1.00
R4997:Invs	UTSW	4	48396332	missense	probably damaging	0.98
R5011:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5013:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5083:Invs	UTSW	4	48396307	missense	possibly damaging	0.90
R5184:Invs	UTSW	4	48283242	utr 5 prime	probably benign
R5258:Invs	UTSW	4	48396374	missense	possibly damaging	0.82
R5375:Invs	UTSW	4	48385262	missense	probably benign	0.12
R5509:Invs	UTSW	4	48396337	missense	probably damaging	1.00
R5560:Invs	UTSW	4	48416084	missense	probably benign	0.00
R5813:Invs	UTSW	4	48398146	missense	probably damaging	0.98
R5840:Invs	UTSW	4	48396284	missense	probably damaging	1.00
R5984:Invs	UTSW	4	48421674	missense	probably benign	0.00
R6513:Invs	UTSW	4	48397534	missense	possibly damaging	0.46
R6637:Invs	UTSW	4	48416203	splice site	probably null
R6667:Invs	UTSW	4	48402870	missense	possibly damaging	0.66
R6838:Invs	UTSW	4	48283278	missense	possibly damaging	0.95
R6921:Invs	UTSW	4	48396260	missense	possibly damaging	0.46
R6945:Invs	UTSW	4	48421785	missense	probably benign	0.00
R7102:Invs	UTSW	4	48407674	missense	probably benign	0.21
R7142:Invs	UTSW	4	48407696	missense	probably damaging	1.00
R7263:Invs	UTSW	4	48396381	missense	probably damaging	1.00
R7283:Invs	UTSW	4	48392526	splice site	probably null
R7461:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7503:Invs	UTSW	4	48396347	missense	probably damaging	0.96
R7581:Invs	UTSW	4	48421909	missense	probably benign	0.00
R7613:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7861:Invs	UTSW	4	48397559	missense	possibly damaging	0.50
R8316:Invs	UTSW	4	48426199	missense	possibly damaging	0.68
R8321:Invs	UTSW	4	48283267	missense	probably benign	0.13
R8500:Invs	UTSW	4	48422109	missense	probably damaging	1.00
R8544:Invs	UTSW	4	48397598	missense	probably damaging	0.96
R9171:Invs	UTSW	4	48398149	missense	possibly damaging	0.90
R9663:Invs	UTSW	4	48426218	missense	probably damaging	1.00
X0026:Invs	UTSW	4	48398221	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCAGGAATGCTACTGTCTACC -3'
(R):5'- TTAGCTGCACTTTAAGCCACAG -3'

Sequencing Primer
(F):5'- CAGGAATGCTACTGTCTACCTCATAG -3'
(R):5'- GCTGCACTTTAAGCCACAGTTTATAG -3'

Posted On

2016-11-21