Mutagenetix > Incidental Mutation

Incidental Mutation 'R5748:Upf1'

445869

Institutional Source

Beutler Lab

Gene Symbol

Upf1

Ensembl Gene

ENSMUSG00000058301

Gene Name

UPF1 regulator of nonsense transcripts homolog (yeast)

Synonyms

B430202H16Rik, PNORF-1, Rent1

MMRRC Submission

043355-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.973) question?

Stock #

R5748 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70331525-70353278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70338517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 525 (L525P)

Ref Sequence

ENSEMBL: ENSMUSP00000148927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075666] [ENSMUST00000215817]

AlphaFold

Q9EPU0

Predicted Effect

probably damaging
Transcript: ENSMUST00000075666
AA Change: L536P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075089
Gene: ENSMUSG00000058301
AA Change: L536P

Domain	Start	End	E-Value	Type
low complexity region	47	67	N/A	INTRINSIC
low complexity region	101	110	N/A	INTRINSIC
Pfam:UPF1_Zn_bind	116	267	4.1e-78	PFAM
Pfam:ResIII	475	617	1.3e-6	PFAM
Pfam:AAA_11	476	600	4.5e-24	PFAM
Pfam:AAA_30	476	688	5.6e-13	PFAM
Pfam:AAA_19	483	559	3.8e-16	PFAM
Pfam:AAA_11	576	679	7.7e-30	PFAM
Pfam:AAA_12	686	883	3.3e-64	PFAM
low complexity region	995	1001	N/A	INTRINSIC
low complexity region	1013	1028	N/A	INTRINSIC
low complexity region	1066	1081	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215817
AA Change: L525P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9686

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located only in the cytoplasm. When translation ends, it interacts with the protein that is a functional homolog of yeast Upf2p to trigger mRNA decapping. Use of multiple polyadenylation sites has been noted for this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable in the pre-implantation period but resorb in the early post-implantation period. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,089,699	Q285R	probably damaging	Het
Acy1	T	A	9: 106,436,727	N78I	probably damaging	Het
Anln	T	C	9: 22,337,934	K166E	probably damaging	Het
C1qtnf4	A	G	2: 90,889,533	D50G	probably damaging	Het
Cntnap2	A	G	6: 45,715,884	T100A	probably damaging	Het
Cxcr6	C	T	9: 123,810,341	R143C	probably damaging	Het
Dhx16	T	C	17: 35,883,314	L439P	probably damaging	Het
Dlk1	T	C	12: 109,459,972	V257A	probably benign	Het
Ebpl	A	T	14: 61,360,344	L16Q	probably null	Het
Eml5	T	A	12: 98,825,555	Y1234F	probably damaging	Het
Fam129b	A	T	2: 32,919,569	K260M	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gria1	A	G	11: 57,309,876	D793G	probably benign	Het
Gtse1	T	C	15: 85,867,577	Y324H	probably benign	Het
Hcn1	A	T	13: 117,976,055	S852C	probably damaging	Het
Invs	A	G	4: 48,307,823	T83A	probably damaging	Het
Iqgap3	T	C	3: 88,109,370	L155P	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc14b	T	A	13: 74,363,640	D107V	probably damaging	Het
Mcm9	A	T	10: 53,625,729	H253Q	probably damaging	Het
Mcmdc2	A	G	1: 9,911,807	Y30C	probably damaging	Het
Mdga1	C	T	17: 29,850,551	D174N	probably benign	Het
Med13l	G	A	5: 118,593,445	R62H	probably damaging	Het
Mrgpra2b	A	G	7: 47,502,532		probably benign	Het
Nacad	T	A	11: 6,598,370	K1426*	probably null	Het
Ndufb6	A	G	4: 40,279,234	L35S	probably damaging	Het
Nkapl	A	G	13: 21,467,609	I278T	probably benign	Het
Nrbp2	T	C	15: 76,089,483	E263G	probably damaging	Het
Nup85	T	A	11: 115,580,512	L110Q	probably damaging	Het
Olfr1251	A	T	2: 89,667,802	M28K	possibly damaging	Het
Olfr1415	T	A	1: 92,491,093	I221F	probably damaging	Het
Olfr1448	T	A	19: 12,920,015	Q98L	probably damaging	Het
Olfr293	A	G	7: 86,664,085	N141S	possibly damaging	Het
Olfr395	A	G	11: 73,906,895	I199T	probably damaging	Het
Olfr720	T	C	14: 14,175,314	Y256C	probably damaging	Het
Polr2m	C	T	9: 71,483,636	D95N	probably benign	Het
Popdc2	A	T	16: 38,374,303	D362V	probably damaging	Het
Pot1a	A	T	6: 25,758,856	I308N	possibly damaging	Het
Rsf1	GCGGCGGC	GCGGCGGCGTCGGCGGC	7: 97,579,928		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rundc3a	G	A	11: 102,399,399	E189K	possibly damaging	Het
Scaf1	A	C	7: 45,012,806		probably null	Het
Scaper	T	C	9: 55,859,076		probably null	Het
Sh3glb1	C	T	3: 144,712,649	C51Y	probably damaging	Het
Slc10a5	T	C	3: 10,335,331	T90A	probably benign	Het
Slc17a3	T	A	13: 23,856,466	S336T	probably damaging	Het
Slc41a2	C	A	10: 83,297,159	C341F	probably benign	Het
Spata31	A	G	13: 64,920,313	*67W	probably null	Het
Stap2	C	T	17: 56,000,475		probably null	Het
Stt3a	A	T	9: 36,752,400	M182K	probably benign	Het
Tcfl5	G	A	2: 180,642,257		silent	Het
Tmx3	T	C	18: 90,537,101	V314A	probably benign	Het
Wdr6	T	C	9: 108,575,782	I301V	possibly damaging	Het
Ylpm1	T	A	12: 85,060,251		probably null	Het
Zfp273	T	C	13: 67,825,331	Y160H	probably damaging	Het

Other mutations in Upf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Upf1	APN	8	70338284	missense	probably benign
IGL01890:Upf1	APN	8	70334230	missense	possibly damaging	0.94
IGL02534:Upf1	APN	8	70335652	critical splice donor site	probably null
IGL03142:Upf1	APN	8	70333327	missense	probably benign	0.04
IGL03151:Upf1	APN	8	70335387	missense	probably damaging	0.98
Nanosphere	UTSW	8	70344262	missense	probably benign	0.01
Particulate	UTSW	8	70337025	missense	probably damaging	0.96
R0270:Upf1	UTSW	8	70335645	splice site	probably benign
R0477:Upf1	UTSW	8	70334080	missense	probably benign
R0755:Upf1	UTSW	8	70334129	missense	probably benign	0.01
R1018:Upf1	UTSW	8	70338906	missense	possibly damaging	0.85
R1067:Upf1	UTSW	8	70338403	missense	probably damaging	0.98
R1445:Upf1	UTSW	8	70341524	missense	probably benign	0.00
R1458:Upf1	UTSW	8	70344254	missense	probably benign	0.00
R1511:Upf1	UTSW	8	70338505	missense	probably damaging	0.99
R1552:Upf1	UTSW	8	70333059	nonsense	probably null
R1560:Upf1	UTSW	8	70338442	missense	probably damaging	1.00
R1562:Upf1	UTSW	8	70343367	nonsense	probably null
R2082:Upf1	UTSW	8	70341572	missense	probably damaging	1.00
R2143:Upf1	UTSW	8	70339354	missense	probably null	1.00
R2423:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R2425:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3031:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3032:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3123:Upf1	UTSW	8	70337483	splice site	probably benign
R3508:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3747:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3748:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3750:Upf1	UTSW	8	70333350	missense	possibly damaging	0.75
R3754:Upf1	UTSW	8	70339814	missense	probably benign	0.30
R3964:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R3965:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4152:Upf1	UTSW	8	70338460	missense	probably damaging	1.00
R4505:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4506:Upf1	UTSW	8	70337566	missense	probably damaging	1.00
R4838:Upf1	UTSW	8	70339368	missense	probably benign	0.03
R5001:Upf1	UTSW	8	70334700	missense	probably damaging	1.00
R5715:Upf1	UTSW	8	70352978	missense	probably damaging	0.96
R5856:Upf1	UTSW	8	70334762	critical splice acceptor site	probably null
R5930:Upf1	UTSW	8	70344262	missense	probably benign	0.01
R6010:Upf1	UTSW	8	70337025	missense	probably damaging	0.96
R6056:Upf1	UTSW	8	70333037	missense	probably damaging	0.98
R6870:Upf1	UTSW	8	70341561	missense	probably benign	0.11
R7205:Upf1	UTSW	8	70340045	missense	possibly damaging	0.94
R7385:Upf1	UTSW	8	70340618	missense	probably damaging	1.00
R7464:Upf1	UTSW	8	70333423	missense	probably benign
R7759:Upf1	UTSW	8	70334080	missense	probably benign
R7783:Upf1	UTSW	8	70352858	missense	probably benign	0.11
R8079:Upf1	UTSW	8	70338884	critical splice donor site	probably null
R8192:Upf1	UTSW	8	70340644	missense	probably benign	0.03
R8544:Upf1	UTSW	8	70337052	missense	probably damaging	1.00
R8738:Upf1	UTSW	8	70333322	missense	probably benign	0.01
R8738:Upf1	UTSW	8	70333323	missense	probably benign	0.06
R8826:Upf1	UTSW	8	70338280	missense	probably benign
R8876:Upf1	UTSW	8	70344268	missense	possibly damaging	0.92
R8906:Upf1	UTSW	8	70334165	nonsense	probably null
R8911:Upf1	UTSW	8	70338437	missense	possibly damaging	0.53
R9163:Upf1	UTSW	8	70340024	missense	probably benign
R9425:Upf1	UTSW	8	70339353	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCATCCTTTAGCTGCTGCAG -3'
(R):5'- ACAGGAGGCTTTGCTTGTTC -3'

Sequencing Primer
(F):5'- TTCTGCAGCTCAGGCATG -3'
(R):5'- CTTGTTCTGCCTTGGCATG -3'

Posted On

2016-11-21