Incidental Mutation 'R5748:Acy1'
ID445872
Institutional Source Beutler Lab
Gene Symbol Acy1
Ensembl Gene ENSMUSG00000023262
Gene Nameaminoacylase 1
Synonyms1110014J22Rik, Acy-1
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106432981-106438319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106436727 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 78 (N78I)
Ref Sequence ENSEMBL: ENSMUSP00000150039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024031] [ENSMUST00000048685] [ENSMUST00000171678] [ENSMUST00000171925] [ENSMUST00000185334] [ENSMUST00000187001] [ENSMUST00000187983] [ENSMUST00000190798] [ENSMUST00000190803] [ENSMUST00000190972] [ENSMUST00000215506] [ENSMUST00000215395] [ENSMUST00000216400] [ENSMUST00000190900] [ENSMUST00000214275]
Predicted Effect probably damaging
Transcript: ENSMUST00000024031
AA Change: N78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024031
Gene: ENSMUSG00000023262
AA Change: N78I

DomainStartEndE-ValueType
Pfam:Peptidase_M28 61 239 8.6e-8 PFAM
Pfam:Peptidase_M20 76 397 1.8e-38 PFAM
Pfam:M20_dimer 188 302 1.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048685
SMART Domains Protein: ENSMUSP00000047322
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171678
SMART Domains Protein: ENSMUSP00000126101
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171925
SMART Domains Protein: ENSMUSP00000126916
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Abhydrolase_5 73 245 7.9e-17 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185334
SMART Domains Protein: ENSMUSP00000140345
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 3.3e-10 PFAM
Pfam:Abhydrolase_5 73 227 8.1e-21 PFAM
Pfam:Abhydrolase_6 74 181 1e-14 PFAM
Pfam:Abhydrolase_6 176 238 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187001
SMART Domains Protein: ENSMUSP00000140042
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
SCOP:d1imja_ 51 110 1e-10 SMART
PDB:1IMJ|A 58 110 6e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187324
Predicted Effect probably benign
Transcript: ENSMUST00000187983
SMART Domains Protein: ENSMUSP00000140901
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Abhydrolase_5 73 203 5.4e-12 PFAM
Pfam:Abhydrolase_6 74 197 1.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189097
Predicted Effect probably benign
Transcript: ENSMUST00000190798
SMART Domains Protein: ENSMUSP00000141096
Gene: ENSMUSG00000042210

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Hydrolase_4 55 142 1.7e-8 PFAM
Pfam:Abhydrolase_5 73 157 1.2e-8 PFAM
Pfam:Abhydrolase_6 74 157 1.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190851
Predicted Effect probably damaging
Transcript: ENSMUST00000190972
AA Change: N78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139953
Gene: ENSMUSG00000023262
AA Change: N78I

DomainStartEndE-ValueType
Pfam:Peptidase_M20 76 216 2.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215506
AA Change: N78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215395
AA Change: N78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216400
AA Change: N78I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000190900
SMART Domains Protein: ENSMUSP00000140582
Gene: ENSMUSG00000023262

DomainStartEndE-ValueType
PDB:1Q7L|C 1 50 9e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000214275
Predicted Effect probably benign
Transcript: ENSMUST00000217531
Meta Mutation Damage Score 0.6207 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, homodimeric, zinc-binding enzyme that catalyzes the hydrolysis of acylated L-amino acids to L-amino acids and an acyl group, and has been postulated to function in the catabolism and salvage of acylated amino acids. This gene is located on chromosome 3p21.1, a region reduced to homozygosity in small-cell lung cancer (SCLC), and its expression has been reported to be reduced or undetectable in SCLC cell lines and tumors. The amino acid sequence of human aminoacylase-1 is highly homologous to the porcine counterpart, and this enzyme is the first member of a new family of zinc-binding enzymes. Mutations in this gene cause aminoacylase-1 deficiency, a metabolic disorder characterized by central nervous system defects and increased urinary excretion of N-acetylated amino acids. Alternative splicing of this gene results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ABHD14A (abhydrolase domain containing 14A) gene, as represented in GeneID:100526760. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Acy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Acy1 APN 9 106436807 unclassified probably benign
IGL03029:Acy1 APN 9 106435115 missense probably damaging 0.98
IGL03304:Acy1 APN 9 106435466 critical splice donor site probably null
R0691:Acy1 UTSW 9 106435871 splice site probably null
R2152:Acy1 UTSW 9 106435617 missense probably damaging 1.00
R3882:Acy1 UTSW 9 106435509 missense possibly damaging 0.75
R4019:Acy1 UTSW 9 106436779 missense possibly damaging 0.94
R4421:Acy1 UTSW 9 106435713 splice site probably null
R4700:Acy1 UTSW 9 106433583 missense probably benign 0.00
R4931:Acy1 UTSW 9 106433191 missense probably damaging 1.00
R4934:Acy1 UTSW 9 106435122 missense probably null 1.00
R5030:Acy1 UTSW 9 106433397 missense probably benign 0.31
R5482:Acy1 UTSW 9 106434639 intron probably benign
R6932:Acy1 UTSW 9 106437627 critical splice donor site probably null
R7468:Acy1 UTSW 9 106437722 start codon destroyed probably null 0.64
R7768:Acy1 UTSW 9 106433618 missense possibly damaging 0.90
R8144:Acy1 UTSW 9 106436120 splice site probably null
R8226:Acy1 UTSW 9 106437658 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAATGGAGCCATGCCATATG -3'
(R):5'- ATCACCTTCCTGGAGGAGAGAG -3'

Sequencing Primer
(F):5'- GCTACATAGTGAGACCCTGTCTAG -3'
(R):5'- AGCTGGGTCTGAGCTGTC -3'
Posted On2016-11-21