Incidental Mutation 'R5748:Nup85'
ID445882
Institutional Source Beutler Lab
Gene Symbol Nup85
Ensembl Gene ENSMUSG00000020739
Gene Namenucleoporin 85
Synonymsfrount, Pcnt1
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115564434-115583985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115580512 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 110 (L110Q)
Ref Sequence ENSEMBL: ENSMUSP00000117333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019135] [ENSMUST00000021085] [ENSMUST00000106508] [ENSMUST00000140986] [ENSMUST00000144473] [ENSMUST00000156173]
Predicted Effect probably benign
Transcript: ENSMUST00000019135
SMART Domains Protein: ENSMUSP00000019135
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 222 299 1.7e-20 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Alpha_adaptinC2 586 710 6.09e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021085
AA Change: L368Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021085
Gene: ENSMUSG00000020739
AA Change: L368Q

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 53 606 1.2e-181 PFAM
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106508
SMART Domains Protein: ENSMUSP00000102117
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 1.3e-32 PFAM
low complexity region 377 393 N/A INTRINSIC
low complexity region 405 420 N/A INTRINSIC
low complexity region 454 476 N/A INTRINSIC
Alpha_adaptinC2 508 632 6.09e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138998
Predicted Effect probably damaging
Transcript: ENSMUST00000140986
AA Change: L110Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117333
Gene: ENSMUSG00000020739
AA Change: L110Q

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 21 280 5.9e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143351
Predicted Effect probably benign
Transcript: ENSMUST00000144473
SMART Domains Protein: ENSMUSP00000116069
Gene: ENSMUSG00000020739

DomainStartEndE-ValueType
Pfam:Nucleopor_Nup85 1 170 3e-56 PFAM
Pfam:Nucleopor_Nup85 168 274 1.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154832
Predicted Effect probably benign
Transcript: ENSMUST00000156173
SMART Domains Protein: ENSMUSP00000138597
Gene: ENSMUSG00000020740

DomainStartEndE-ValueType
VHS 9 142 9.36e-55 SMART
low complexity region 174 185 N/A INTRINSIC
Pfam:GAT 206 307 7.3e-32 PFAM
low complexity region 334 369 N/A INTRINSIC
low complexity region 383 395 N/A INTRINSIC
low complexity region 455 471 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Meta Mutation Damage Score 0.4526 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Nup85
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Nup85 APN 11 115581756 missense probably damaging 1.00
IGL01538:Nup85 APN 11 115569714 missense possibly damaging 0.81
IGL01775:Nup85 APN 11 115580767 missense probably damaging 1.00
IGL02170:Nup85 APN 11 115577931 missense probably damaging 0.97
IGL02456:Nup85 APN 11 115581865 unclassified probably benign
IGL02888:Nup85 APN 11 115578800 missense possibly damaging 0.89
IGL03210:Nup85 APN 11 115566636 missense probably benign 0.11
PIT4403001:Nup85 UTSW 11 115581820 missense probably damaging 0.98
R0195:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0394:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0639:Nup85 UTSW 11 115564531 start codon destroyed probably null 1.00
R0883:Nup85 UTSW 11 115568370 nonsense probably null
R1567:Nup85 UTSW 11 115568398 missense possibly damaging 0.83
R1774:Nup85 UTSW 11 115582945 missense probably benign 0.01
R1846:Nup85 UTSW 11 115568413 missense probably benign 0.11
R1851:Nup85 UTSW 11 115581817 missense probably damaging 1.00
R2084:Nup85 UTSW 11 115568691 missense possibly damaging 0.71
R4766:Nup85 UTSW 11 115577925 splice site probably null
R6362:Nup85 UTSW 11 115583734 missense probably damaging 0.98
R6906:Nup85 UTSW 11 115580943 missense probably damaging 1.00
R6951:Nup85 UTSW 11 115582955 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCATTTCTCTGTTCGACC -3'
(R):5'- CACTTTGTGGCTCCTGCAG -3'

Sequencing Primer
(F):5'- TCAGATCCCATTACAGAGGGTTG -3'
(R):5'- GCTCCTGCAGCCTACCTG -3'
Posted On2016-11-21