Incidental Mutation 'R5748:Ylpm1'
ID445883
Institutional Source Beutler Lab
Gene Symbol Ylpm1
Ensembl Gene ENSMUSG00000021244
Gene NameYLP motif containing 1
SynonymsZAP, A930013E17Rik, Zap3
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84996321-85070515 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 85060251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]
Predicted Effect probably null
Transcript: ENSMUST00000021670
SMART Domains Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
internal_repeat_1 771 840 4.03e-5 PROSPERO
low complexity region 841 854 N/A INTRINSIC
low complexity region 966 972 N/A INTRINSIC
internal_repeat_1 1062 1124 4.03e-5 PROSPERO
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1326 1338 N/A INTRINSIC
low complexity region 1339 1353 N/A INTRINSIC
low complexity region 1408 1425 N/A INTRINSIC
coiled coil region 1447 1474 N/A INTRINSIC
low complexity region 1494 1517 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1557 N/A INTRINSIC
low complexity region 1598 1630 N/A INTRINSIC
low complexity region 1678 1694 N/A INTRINSIC
low complexity region 1705 1717 N/A INTRINSIC
low complexity region 1720 1736 N/A INTRINSIC
low complexity region 1797 1808 N/A INTRINSIC
Pfam:AAA_33 1829 1990 7.8e-11 PFAM
coiled coil region 1995 2032 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101202
SMART Domains Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 206 N/A INTRINSIC
low complexity region 294 335 N/A INTRINSIC
low complexity region 342 360 N/A INTRINSIC
low complexity region 375 388 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 491 607 N/A INTRINSIC
low complexity region 641 649 N/A INTRINSIC
low complexity region 741 764 N/A INTRINSIC
low complexity region 765 779 N/A INTRINSIC
low complexity region 783 804 N/A INTRINSIC
low complexity region 845 877 N/A INTRINSIC
low complexity region 925 941 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 967 983 N/A INTRINSIC
low complexity region 1044 1055 N/A INTRINSIC
Pfam:AAA_33 1076 1265 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164558
SMART Domains Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 80 196 N/A INTRINSIC
low complexity region 230 238 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 508 514 N/A INTRINSIC
low complexity region 794 808 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
coiled coil region 989 1016 N/A INTRINSIC
low complexity region 1036 1059 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1078 1099 N/A INTRINSIC
low complexity region 1140 1172 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1259 N/A INTRINSIC
low complexity region 1262 1278 N/A INTRINSIC
low complexity region 1339 1350 N/A INTRINSIC
Pfam:AAA_33 1371 1559 5.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167838
Predicted Effect probably null
Transcript: ENSMUST00000168977
SMART Domains Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 31 50 N/A INTRINSIC
low complexity region 57 78 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
low complexity region 94 114 N/A INTRINSIC
low complexity region 139 225 N/A INTRINSIC
low complexity region 226 253 N/A INTRINSIC
low complexity region 341 382 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 455 464 N/A INTRINSIC
low complexity region 538 654 N/A INTRINSIC
low complexity region 688 696 N/A INTRINSIC
low complexity region 788 811 N/A INTRINSIC
low complexity region 812 826 N/A INTRINSIC
low complexity region 830 851 N/A INTRINSIC
low complexity region 892 924 N/A INTRINSIC
low complexity region 972 988 N/A INTRINSIC
low complexity region 999 1011 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1091 1102 N/A INTRINSIC
Pfam:AAA_33 1123 1311 4.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169150
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Ylpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ylpm1 APN 12 85028954 missense possibly damaging 0.93
IGL00809:Ylpm1 APN 12 85049194 missense probably damaging 0.99
IGL01508:Ylpm1 APN 12 85015455 missense possibly damaging 0.74
IGL02199:Ylpm1 APN 12 85034005 nonsense probably null
IGL02392:Ylpm1 APN 12 85014957 missense unknown
IGL02455:Ylpm1 APN 12 85030263 missense probably damaging 1.00
IGL02506:Ylpm1 APN 12 85049191 missense probably damaging 1.00
IGL03102:Ylpm1 APN 12 85049258 splice site probably benign
I1329:Ylpm1 UTSW 12 85040880 missense probably damaging 1.00
IGL02799:Ylpm1 UTSW 12 85044484 missense probably damaging 1.00
R0010:Ylpm1 UTSW 12 85029026 missense probably damaging 0.97
R0090:Ylpm1 UTSW 12 85029040 intron probably benign
R0149:Ylpm1 UTSW 12 85028838 missense probably damaging 0.99
R0226:Ylpm1 UTSW 12 85049737 missense probably benign 0.21
R0375:Ylpm1 UTSW 12 85014980 missense unknown
R0378:Ylpm1 UTSW 12 84997076 intron probably benign
R0507:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R0742:Ylpm1 UTSW 12 85029112 missense probably benign 0.03
R1350:Ylpm1 UTSW 12 85014082 unclassified probably benign
R1452:Ylpm1 UTSW 12 85030383 missense possibly damaging 0.94
R1500:Ylpm1 UTSW 12 85014996 missense unknown
R1837:Ylpm1 UTSW 12 85029333 missense possibly damaging 0.92
R1945:Ylpm1 UTSW 12 85015418 missense probably damaging 0.98
R1971:Ylpm1 UTSW 12 85040786 missense probably damaging 1.00
R2211:Ylpm1 UTSW 12 85044378 nonsense probably null
R2213:Ylpm1 UTSW 12 85069718 missense probably benign 0.25
R2269:Ylpm1 UTSW 12 85015050 missense unknown
R2300:Ylpm1 UTSW 12 85060319 splice site probably null
R2439:Ylpm1 UTSW 12 85014117 unclassified probably benign
R2497:Ylpm1 UTSW 12 84996761 missense probably damaging 0.98
R2890:Ylpm1 UTSW 12 85029813 missense probably damaging 0.99
R3111:Ylpm1 UTSW 12 85029371 missense probably damaging 0.98
R3436:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R3437:Ylpm1 UTSW 12 85049870 critical splice donor site probably null
R4156:Ylpm1 UTSW 12 85057403 intron probably benign
R4157:Ylpm1 UTSW 12 85057403 intron probably benign
R4959:Ylpm1 UTSW 12 85049945 missense probably damaging 1.00
R5014:Ylpm1 UTSW 12 85014749 missense unknown
R5039:Ylpm1 UTSW 12 85015493 missense probably damaging 0.98
R5039:Ylpm1 UTSW 12 85042239 missense probably damaging 1.00
R5084:Ylpm1 UTSW 12 85029321 missense probably damaging 0.99
R5325:Ylpm1 UTSW 12 85013961 unclassified probably benign
R5378:Ylpm1 UTSW 12 85030255 missense probably damaging 0.99
R5428:Ylpm1 UTSW 12 85030229 missense probably benign 0.04
R5467:Ylpm1 UTSW 12 84996859 missense unknown
R5605:Ylpm1 UTSW 12 85028853 missense probably damaging 1.00
R5614:Ylpm1 UTSW 12 85064944 intron probably benign
R5860:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5861:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5881:Ylpm1 UTSW 12 85042125 missense probably damaging 1.00
R5909:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5912:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R5915:Ylpm1 UTSW 12 85040886 missense probably damaging 1.00
R6000:Ylpm1 UTSW 12 84997256 missense unknown
R6004:Ylpm1 UTSW 12 85029084 missense possibly damaging 0.78
R6007:Ylpm1 UTSW 12 85029290 missense probably benign 0.33
R6053:Ylpm1 UTSW 12 84996503 missense possibly damaging 0.72
R6104:Ylpm1 UTSW 12 85029630 missense probably benign 0.00
R6197:Ylpm1 UTSW 12 85042179 missense probably damaging 1.00
R6293:Ylpm1 UTSW 12 85015277 missense unknown
R6297:Ylpm1 UTSW 12 85015277 missense unknown
R6305:Ylpm1 UTSW 12 85030545 missense probably damaging 1.00
R6379:Ylpm1 UTSW 12 85030800 missense probably damaging 1.00
R6465:Ylpm1 UTSW 12 85049802 missense probably damaging 1.00
R6608:Ylpm1 UTSW 12 85015277 missense unknown
R6609:Ylpm1 UTSW 12 85015277 missense unknown
R6737:Ylpm1 UTSW 12 85030846 missense probably damaging 0.98
R6794:Ylpm1 UTSW 12 84996881 missense unknown
R7383:Ylpm1 UTSW 12 85044468 missense possibly damaging 0.93
R7514:Ylpm1 UTSW 12 85030494 missense possibly damaging 0.94
R7577:Ylpm1 UTSW 12 84997220 missense unknown
R7709:Ylpm1 UTSW 12 85013025 missense unknown
R7718:Ylpm1 UTSW 12 85029122 missense probably damaging 0.99
R7736:Ylpm1 UTSW 12 85012983 missense unknown
R7758:Ylpm1 UTSW 12 85015022 missense unknown
R7807:Ylpm1 UTSW 12 85014081 nonsense probably null
R7838:Ylpm1 UTSW 12 85048866 missense possibly damaging 0.90
R7846:Ylpm1 UTSW 12 85057268 missense probably damaging 0.98
R8170:Ylpm1 UTSW 12 85034027 missense probably benign 0.40
Z1088:Ylpm1 UTSW 12 85030155 missense possibly damaging 0.95
Z1176:Ylpm1 UTSW 12 85030284 missense possibly damaging 0.93
Z1177:Ylpm1 UTSW 12 85057283 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCATGATCCTACCCTGATGACTG -3'
(R):5'- TGGGTTGGCCAAAATCTTGC -3'

Sequencing Primer
(F):5'- GATCCTACCCTGATGACTGAAATCTG -3'
(R):5'- GCTTTAAGCAGAAGTTTCCGGCC -3'
Posted On2016-11-21