Mutagenetix > Incidental Mutations

Incidental Mutation 'R5748:Ylpm1'

445883

Institutional Source

Beutler Lab

Gene Symbol

Ylpm1

Ensembl Gene

ENSMUSG00000021244

Gene Name

YLP motif containing 1

Synonyms

ZAP, A930013E17Rik, Zap3

MMRRC Submission

043355-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5748 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84996321-85070515 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 85060251 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]

Predicted Effect

probably null
Transcript: ENSMUST00000021670

SMART Domains

Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
low complexity region	31	50	N/A	INTRINSIC
low complexity region	57	78	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
low complexity region	94	114	N/A	INTRINSIC
low complexity region	139	225	N/A	INTRINSIC
low complexity region	226	253	N/A	INTRINSIC
low complexity region	341	382	N/A	INTRINSIC
low complexity region	389	407	N/A	INTRINSIC
low complexity region	422	435	N/A	INTRINSIC
low complexity region	455	464	N/A	INTRINSIC
low complexity region	538	654	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	751	763	N/A	INTRINSIC
internal_repeat_1	771	840	4.03e-5	PROSPERO
low complexity region	841	854	N/A	INTRINSIC
low complexity region	966	972	N/A	INTRINSIC
internal_repeat_1	1062	1124	4.03e-5	PROSPERO
low complexity region	1252	1266	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1326	1338	N/A	INTRINSIC
low complexity region	1339	1353	N/A	INTRINSIC
low complexity region	1408	1425	N/A	INTRINSIC
coiled coil region	1447	1474	N/A	INTRINSIC
low complexity region	1494	1517	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1536	1557	N/A	INTRINSIC
low complexity region	1598	1630	N/A	INTRINSIC
low complexity region	1678	1694	N/A	INTRINSIC
low complexity region	1705	1717	N/A	INTRINSIC
low complexity region	1720	1736	N/A	INTRINSIC
low complexity region	1797	1808	N/A	INTRINSIC
Pfam:AAA_33	1829	1990	7.8e-11	PFAM
coiled coil region	1995	2032	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000101202

SMART Domains

Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
low complexity region	31	50	N/A	INTRINSIC
low complexity region	57	78	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
low complexity region	94	114	N/A	INTRINSIC
low complexity region	139	206	N/A	INTRINSIC
low complexity region	294	335	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
low complexity region	375	388	N/A	INTRINSIC
low complexity region	408	417	N/A	INTRINSIC
low complexity region	491	607	N/A	INTRINSIC
low complexity region	641	649	N/A	INTRINSIC
low complexity region	741	764	N/A	INTRINSIC
low complexity region	765	779	N/A	INTRINSIC
low complexity region	783	804	N/A	INTRINSIC
low complexity region	845	877	N/A	INTRINSIC
low complexity region	925	941	N/A	INTRINSIC
low complexity region	952	964	N/A	INTRINSIC
low complexity region	967	983	N/A	INTRINSIC
low complexity region	1044	1055	N/A	INTRINSIC
Pfam:AAA_33	1076	1265	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164558

SMART Domains

Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244

Domain	Start	End	E-Value	Type
low complexity region	80	196	N/A	INTRINSIC
low complexity region	230	238	N/A	INTRINSIC
low complexity region	293	305	N/A	INTRINSIC
low complexity region	383	396	N/A	INTRINSIC
low complexity region	508	514	N/A	INTRINSIC
low complexity region	794	808	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	868	880	N/A	INTRINSIC
low complexity region	881	895	N/A	INTRINSIC
low complexity region	950	967	N/A	INTRINSIC
coiled coil region	989	1016	N/A	INTRINSIC
low complexity region	1036	1059	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1078	1099	N/A	INTRINSIC
low complexity region	1140	1172	N/A	INTRINSIC
low complexity region	1220	1236	N/A	INTRINSIC
low complexity region	1247	1259	N/A	INTRINSIC
low complexity region	1262	1278	N/A	INTRINSIC
low complexity region	1339	1350	N/A	INTRINSIC
Pfam:AAA_33	1371	1559	5.2e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166605

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167838

Predicted Effect

probably null
Transcript: ENSMUST00000168977

SMART Domains

Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
low complexity region	31	50	N/A	INTRINSIC
low complexity region	57	78	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
low complexity region	94	114	N/A	INTRINSIC
low complexity region	139	225	N/A	INTRINSIC
low complexity region	226	253	N/A	INTRINSIC
low complexity region	341	382	N/A	INTRINSIC
low complexity region	389	407	N/A	INTRINSIC
low complexity region	422	435	N/A	INTRINSIC
low complexity region	455	464	N/A	INTRINSIC
low complexity region	538	654	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	788	811	N/A	INTRINSIC
low complexity region	812	826	N/A	INTRINSIC
low complexity region	830	851	N/A	INTRINSIC
low complexity region	892	924	N/A	INTRINSIC
low complexity region	972	988	N/A	INTRINSIC
low complexity region	999	1011	N/A	INTRINSIC
low complexity region	1014	1030	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:AAA_33	1123	1311	4.5e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169150

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,089,699	Q285R	probably damaging	Het
Acy1	T	A	9: 106,436,727	N78I	probably damaging	Het
Anln	T	C	9: 22,337,934	K166E	probably damaging	Het
C1qtnf4	A	G	2: 90,889,533	D50G	probably damaging	Het
Cntnap2	A	G	6: 45,715,884	T100A	probably damaging	Het
Cxcr6	C	T	9: 123,810,341	R143C	probably damaging	Het
Dhx16	T	C	17: 35,883,314	L439P	probably damaging	Het
Dlk1	T	C	12: 109,459,972	V257A	probably benign	Het
Ebpl	A	T	14: 61,360,344	L16Q	probably null	Het
Eml5	T	A	12: 98,825,555	Y1234F	probably damaging	Het
Fam129b	A	T	2: 32,919,569	K260M	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gria1	A	G	11: 57,309,876	D793G	probably benign	Het
Gtse1	T	C	15: 85,867,577	Y324H	probably benign	Het
Hcn1	A	T	13: 117,976,055	S852C	probably damaging	Het
Invs	A	G	4: 48,307,823	T83A	probably damaging	Het
Iqgap3	T	C	3: 88,109,370	L155P	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc14b	T	A	13: 74,363,640	D107V	probably damaging	Het
Mcm9	A	T	10: 53,625,729	H253Q	probably damaging	Het
Mcmdc2	A	G	1: 9,911,807	Y30C	probably damaging	Het
Mdga1	C	T	17: 29,850,551	D174N	probably benign	Het
Med13l	G	A	5: 118,593,445	R62H	probably damaging	Het
Mrgpra2b	A	G	7: 47,502,532		probably benign	Het
Nacad	T	A	11: 6,598,370	K1426*	probably null	Het
Ndufb6	A	G	4: 40,279,234	L35S	probably damaging	Het
Nkapl	A	G	13: 21,467,609	I278T	probably benign	Het
Nrbp2	T	C	15: 76,089,483	E263G	probably damaging	Het
Nup85	T	A	11: 115,580,512	L110Q	probably damaging	Het
Olfr1251	A	T	2: 89,667,802	M28K	possibly damaging	Het
Olfr1415	T	A	1: 92,491,093	I221F	probably damaging	Het
Olfr1448	T	A	19: 12,920,015	Q98L	probably damaging	Het
Olfr293	A	G	7: 86,664,085	N141S	possibly damaging	Het
Olfr395	A	G	11: 73,906,895	I199T	probably damaging	Het
Olfr720	T	C	14: 14,175,314	Y256C	probably damaging	Het
Polr2m	C	T	9: 71,483,636	D95N	probably benign	Het
Popdc2	A	T	16: 38,374,303	D362V	probably damaging	Het
Pot1a	A	T	6: 25,758,856	I308N	possibly damaging	Het
Rsf1	GCGGCGGC	GCGGCGGCGTCGGCGGC	7: 97,579,928		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rundc3a	G	A	11: 102,399,399	E189K	possibly damaging	Het
Scaf1	A	C	7: 45,012,806		probably null	Het
Scaper	T	C	9: 55,859,076		probably null	Het
Sh3glb1	C	T	3: 144,712,649	C51Y	probably damaging	Het
Slc10a5	T	C	3: 10,335,331	T90A	probably benign	Het
Slc17a3	T	A	13: 23,856,466	S336T	probably damaging	Het
Slc41a2	C	A	10: 83,297,159	C341F	probably benign	Het
Spata31	A	G	13: 64,920,313	*67W	probably null	Het
Stap2	C	T	17: 56,000,475		probably null	Het
Stt3a	A	T	9: 36,752,400	M182K	probably benign	Het
Tcfl5	G	A	2: 180,642,257		silent	Het
Tmx3	T	C	18: 90,537,101	V314A	probably benign	Het
Upf1	A	G	8: 70,338,517	L525P	probably damaging	Het
Wdr6	T	C	9: 108,575,782	I301V	possibly damaging	Het
Zfp273	T	C	13: 67,825,331	Y160H	probably damaging	Het

Other mutations in Ylpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ylpm1	APN	12	85028954	missense	possibly damaging	0.93
IGL00809:Ylpm1	APN	12	85049194	missense	probably damaging	0.99
IGL01508:Ylpm1	APN	12	85015455	missense	possibly damaging	0.74
IGL02199:Ylpm1	APN	12	85034005	nonsense	probably null
IGL02392:Ylpm1	APN	12	85014957	missense	unknown
IGL02455:Ylpm1	APN	12	85030263	missense	probably damaging	1.00
IGL02506:Ylpm1	APN	12	85049191	missense	probably damaging	1.00
IGL03102:Ylpm1	APN	12	85049258	splice site	probably benign
I1329:Ylpm1	UTSW	12	85040880	missense	probably damaging	1.00
IGL02799:Ylpm1	UTSW	12	85044484	missense	probably damaging	1.00
R0010:Ylpm1	UTSW	12	85029026	missense	probably damaging	0.97
R0090:Ylpm1	UTSW	12	85029040	intron	probably benign
R0149:Ylpm1	UTSW	12	85028838	missense	probably damaging	0.99
R0226:Ylpm1	UTSW	12	85049737	missense	probably benign	0.21
R0375:Ylpm1	UTSW	12	85014980	missense	unknown
R0378:Ylpm1	UTSW	12	84997076	intron	probably benign
R0507:Ylpm1	UTSW	12	85029112	missense	probably benign	0.03
R0742:Ylpm1	UTSW	12	85029112	missense	probably benign	0.03
R1350:Ylpm1	UTSW	12	85014082	unclassified	probably benign
R1452:Ylpm1	UTSW	12	85030383	missense	possibly damaging	0.94
R1500:Ylpm1	UTSW	12	85014996	missense	unknown
R1837:Ylpm1	UTSW	12	85029333	missense	possibly damaging	0.92
R1945:Ylpm1	UTSW	12	85015418	missense	probably damaging	0.98
R1971:Ylpm1	UTSW	12	85040786	missense	probably damaging	1.00
R2211:Ylpm1	UTSW	12	85044378	nonsense	probably null
R2213:Ylpm1	UTSW	12	85069718	missense	probably benign	0.25
R2269:Ylpm1	UTSW	12	85015050	missense	unknown
R2300:Ylpm1	UTSW	12	85060319	splice site	probably null
R2439:Ylpm1	UTSW	12	85014117	unclassified	probably benign
R2497:Ylpm1	UTSW	12	84996761	missense	probably damaging	0.98
R2890:Ylpm1	UTSW	12	85029813	missense	probably damaging	0.99
R3111:Ylpm1	UTSW	12	85029371	missense	probably damaging	0.98
R3436:Ylpm1	UTSW	12	85049870	critical splice donor site	probably null
R3437:Ylpm1	UTSW	12	85049870	critical splice donor site	probably null
R4156:Ylpm1	UTSW	12	85057403	intron	probably benign
R4157:Ylpm1	UTSW	12	85057403	intron	probably benign
R4959:Ylpm1	UTSW	12	85049945	missense	probably damaging	1.00
R5014:Ylpm1	UTSW	12	85014749	missense	unknown
R5039:Ylpm1	UTSW	12	85015493	missense	probably damaging	0.98
R5039:Ylpm1	UTSW	12	85042239	missense	probably damaging	1.00
R5084:Ylpm1	UTSW	12	85029321	missense	probably damaging	0.99
R5325:Ylpm1	UTSW	12	85013961	unclassified	probably benign
R5378:Ylpm1	UTSW	12	85030255	missense	probably damaging	0.99
R5428:Ylpm1	UTSW	12	85030229	missense	probably benign	0.04
R5467:Ylpm1	UTSW	12	84996859	missense	unknown
R5605:Ylpm1	UTSW	12	85028853	missense	probably damaging	1.00
R5614:Ylpm1	UTSW	12	85064944	intron	probably benign
R5860:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5861:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5881:Ylpm1	UTSW	12	85042125	missense	probably damaging	1.00
R5909:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5912:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5915:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R6000:Ylpm1	UTSW	12	84997256	missense	unknown
R6004:Ylpm1	UTSW	12	85029084	missense	possibly damaging	0.78
R6007:Ylpm1	UTSW	12	85029290	missense	probably benign	0.33
R6053:Ylpm1	UTSW	12	84996503	missense	possibly damaging	0.72
R6104:Ylpm1	UTSW	12	85029630	missense	probably benign	0.00
R6197:Ylpm1	UTSW	12	85042179	missense	probably damaging	1.00
R6293:Ylpm1	UTSW	12	85015277	missense	unknown
R6297:Ylpm1	UTSW	12	85015277	missense	unknown
R6305:Ylpm1	UTSW	12	85030545	missense	probably damaging	1.00
R6379:Ylpm1	UTSW	12	85030800	missense	probably damaging	1.00
R6465:Ylpm1	UTSW	12	85049802	missense	probably damaging	1.00
R6608:Ylpm1	UTSW	12	85015277	missense	unknown
R6609:Ylpm1	UTSW	12	85015277	missense	unknown
R6737:Ylpm1	UTSW	12	85030846	missense	probably damaging	0.98
R6794:Ylpm1	UTSW	12	84996881	missense	unknown
R7383:Ylpm1	UTSW	12	85044468	missense	possibly damaging	0.93
R7514:Ylpm1	UTSW	12	85030494	missense	possibly damaging	0.94
R7577:Ylpm1	UTSW	12	84997220	missense	unknown
R7709:Ylpm1	UTSW	12	85013025	missense	unknown
R7718:Ylpm1	UTSW	12	85029122	missense	probably damaging	0.99
R7736:Ylpm1	UTSW	12	85012983	missense	unknown
R7758:Ylpm1	UTSW	12	85015022	missense	unknown
R7807:Ylpm1	UTSW	12	85014081	nonsense	probably null
R7838:Ylpm1	UTSW	12	85048866	missense	possibly damaging	0.90
R7846:Ylpm1	UTSW	12	85057268	missense	probably damaging	0.98
R8170:Ylpm1	UTSW	12	85034027	missense	probably benign	0.40
R8776:Ylpm1	UTSW	12	85030421	missense	probably damaging	1.00
R8776-TAIL:Ylpm1	UTSW	12	85030421	missense	probably damaging	1.00
R8812:Ylpm1	UTSW	12	84996792	missense	unknown
R8847:Ylpm1	UTSW	12	85014898	missense	unknown
R8874:Ylpm1	UTSW	12	85069620	missense	probably damaging	1.00
Z1088:Ylpm1	UTSW	12	85030155	missense	possibly damaging	0.95
Z1176:Ylpm1	UTSW	12	85030284	missense	possibly damaging	0.93
Z1177:Ylpm1	UTSW	12	85057283	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTCATGATCCTACCCTGATGACTG -3'
(R):5'- TGGGTTGGCCAAAATCTTGC -3'

Sequencing Primer
(F):5'- GATCCTACCCTGATGACTGAAATCTG -3'
(R):5'- GCTTTAAGCAGAAGTTTCCGGCC -3'

Posted On

2016-11-21