Incidental Mutation 'R5748:Eml5'
ID 445884
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
MMRRC Submission 043355-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.237) question?
Stock # R5748 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98825555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1234 (Y1234F)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect possibly damaging
Transcript: ENSMUST00000065716
AA Change: Y1195F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y1195F

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000222128
AA Change: Y19F
Predicted Effect probably damaging
Transcript: ENSMUST00000223282
AA Change: Y1234F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Meta Mutation Damage Score 0.4955 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
R9570:Eml5 UTSW 12 98815984 missense probably benign 0.15
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATGCACGCCAGTCATGAGTC -3'
(R):5'- GGTACTTACCAATGAAAGCACAAG -3'

Sequencing Primer
(F):5'- TTGCTGTAAAGCTGACCAAAAC -3'
(R):5'- TACCAATGAAAGCACAAGTGAATTG -3'
Posted On 2016-11-21