Incidental Mutation 'R5748:Dlk1'
ID445885
Institutional Source Beutler Lab
Gene Symbol Dlk1
Ensembl Gene ENSMUSG00000040856
Gene Namedelta like non-canonical Notch ligand 1
SynonymspG2, SCP1, ZOG, FA1, Peg9, pref-1, DlkI
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.714) question?
Stock #R5748 (G1)
Quality Score111
Status Validated
Chromosome12
Chromosomal Location109452823-109463336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109459972 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 257 (V257A)
Ref Sequence ENSEMBL: ENSMUSP00000105470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056110] [ENSMUST00000109841] [ENSMUST00000109842] [ENSMUST00000109843] [ENSMUST00000109844] [ENSMUST00000109846] [ENSMUST00000124293] [ENSMUST00000173539]
Predicted Effect probably benign
Transcript: ENSMUST00000056110
AA Change: V257A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000063104
Gene: ENSMUSG00000040856
AA Change: V257A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109841
SMART Domains Protein: ENSMUSP00000105467
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 214 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109842
SMART Domains Protein: ENSMUSP00000105468
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109843
SMART Domains Protein: ENSMUSP00000105469
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 212 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109844
AA Change: V257A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000105470
Gene: ENSMUSG00000040856
AA Change: V257A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
EGF 213 247 4.06e-6 SMART
transmembrane domain 307 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109846
SMART Domains Protein: ENSMUSP00000105472
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 256 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124293
SMART Domains Protein: ENSMUSP00000133530
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
EGF 24 54 1.43e-1 SMART
EGF 55 85 1.26e-2 SMART
EGF_CA 87 124 1.77e-6 SMART
EGF 129 167 8.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173539
SMART Domains Protein: ENSMUSP00000133430
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF 25 55 1.43e-1 SMART
EGF 56 86 1.26e-2 SMART
EGF_CA 88 125 1.77e-6 SMART
EGF 130 168 8.71e-6 SMART
EGF 175 208 1.41e-5 SMART
transmembrane domain 232 254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173812
SMART Domains Protein: ENSMUSP00000134308
Gene: ENSMUSG00000040856

DomainStartEndE-ValueType
SCOP:d1eqga2 2 15 4e-3 SMART
transmembrane domain 44 66 N/A INTRINSIC
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains multiple epidermal growth factor repeats that functions as a regulator of cell growth. The encoded protein is involved in the differentiation of several cell types including adipocytes. This gene is located in a region of chromosome 14 frequently showing unparental disomy, and is imprinted and expressed from the paternal allele. A single nucleotide variant in this gene is associated with child and adolescent obesity and shows polar overdominance, where heterozygotes carrying an active paternal allele express the phenotype, while mutant homozygotes are normal. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygote null mice have reduced fetal growth and 50% lethality 2 days after birth. Survivors are small but have enlarged fat pad masses. Homozygotes for another null allele have abnormal B cell development. Paternally-inherited null alleles phenocopy homozygotes due to maternal imprinting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Dlk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0041:Dlk1 UTSW 12 109455513 missense probably damaging 1.00
R0379:Dlk1 UTSW 12 109455059 unclassified probably benign
R1250:Dlk1 UTSW 12 109459818 missense probably damaging 1.00
R1363:Dlk1 UTSW 12 109455504 missense probably damaging 1.00
R1757:Dlk1 UTSW 12 109459687 missense probably damaging 1.00
R1763:Dlk1 UTSW 12 109458119 missense probably damaging 1.00
R1772:Dlk1 UTSW 12 109459759 missense probably damaging 1.00
R2189:Dlk1 UTSW 12 109455049 critical splice donor site probably null
R2334:Dlk1 UTSW 12 109453688 missense probably damaging 0.96
R3751:Dlk1 UTSW 12 109460313 missense probably benign 0.15
R5256:Dlk1 UTSW 12 109459771 missense probably damaging 1.00
R5268:Dlk1 UTSW 12 109459838 missense probably benign 0.34
R5356:Dlk1 UTSW 12 109455521 missense probably damaging 0.99
R5669:Dlk1 UTSW 12 109460038 missense probably benign 0.04
R5992:Dlk1 UTSW 12 109455581 missense probably damaging 1.00
R6076:Dlk1 UTSW 12 109459969 missense probably damaging 0.98
R6539:Dlk1 UTSW 12 109460319 missense probably benign 0.01
R6638:Dlk1 UTSW 12 109460278 missense probably damaging 1.00
R7480:Dlk1 UTSW 12 109455614 missense probably damaging 1.00
R7553:Dlk1 UTSW 12 109454963 missense unknown
R7602:Dlk1 UTSW 12 109455625 critical splice donor site probably null
X0020:Dlk1 UTSW 12 109459912 missense probably damaging 1.00
X0053:Dlk1 UTSW 12 109460137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGATTCGTCGACAAGAC -3'
(R):5'- TTCGCACTTGTTGAGAAAGAC -3'

Sequencing Primer
(F):5'- GATTCGTCGACAAGACCTGCAG -3'
(R):5'- CACTTGTTGAGAAAGACGATGGCC -3'
Posted On2016-11-21