Mutagenetix > Incidental Mutations

Incidental Mutation 'R5748:Slc17a3'

445887

Institutional Source

Beutler Lab

Gene Symbol

Slc17a3

Ensembl Gene

ENSMUSG00000036083

Gene Name

solute carrier family 17 (sodium phosphate), member 3

Synonyms

Npt4

MMRRC Submission

043355-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5748 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23839434-23860716 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23856466 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 336 (S336T)

Ref Sequence

ENSEMBL: ENSMUSP00000131308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039721
AA Change: S336T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: S336T

Domain	Start	End	E-Value	Type
Pfam:MFS_1	45	377	3.3e-46	PFAM
transmembrane domain	393	415	N/A	INTRINSIC
transmembrane domain	430	452	N/A	INTRINSIC
transmembrane domain	459	481	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000091698
AA Change: S258T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: S258T

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
Pfam:MFS_1	95	293	2.8e-25	PFAM
transmembrane domain	310	332	N/A	INTRINSIC
transmembrane domain	352	369	N/A	INTRINSIC
transmembrane domain	379	398	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110422
AA Change: S300T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: S300T

Domain	Start	End	E-Value	Type
Pfam:MFS_1	39	425	6.7e-47	PFAM
transmembrane domain	453	475	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166467
AA Change: S336T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: S336T

Domain	Start	End	E-Value	Type
Pfam:MFS_1	9	338	2.3e-46	PFAM
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	394	416	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC

Meta Mutation Damage Score

0.6729

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 96.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acan	A	G	7: 79,089,699	Q285R	probably damaging	Het
Acy1	T	A	9: 106,436,727	N78I	probably damaging	Het
Anln	T	C	9: 22,337,934	K166E	probably damaging	Het
C1qtnf4	A	G	2: 90,889,533	D50G	probably damaging	Het
Cntnap2	A	G	6: 45,715,884	T100A	probably damaging	Het
Cxcr6	C	T	9: 123,810,341	R143C	probably damaging	Het
Dhx16	T	C	17: 35,883,314	L439P	probably damaging	Het
Dlk1	T	C	12: 109,459,972	V257A	probably benign	Het
Ebpl	A	T	14: 61,360,344	L16Q	probably null	Het
Eml5	T	A	12: 98,825,555	Y1234F	probably damaging	Het
Fam129b	A	T	2: 32,919,569	K260M	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gria1	A	G	11: 57,309,876	D793G	probably benign	Het
Gtse1	T	C	15: 85,867,577	Y324H	probably benign	Het
Hcn1	A	T	13: 117,976,055	S852C	probably damaging	Het
Invs	A	G	4: 48,307,823	T83A	probably damaging	Het
Iqgap3	T	C	3: 88,109,370	L155P	probably damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc14b	T	A	13: 74,363,640	D107V	probably damaging	Het
Mcm9	A	T	10: 53,625,729	H253Q	probably damaging	Het
Mcmdc2	A	G	1: 9,911,807	Y30C	probably damaging	Het
Mdga1	C	T	17: 29,850,551	D174N	probably benign	Het
Med13l	G	A	5: 118,593,445	R62H	probably damaging	Het
Mrgpra2b	A	G	7: 47,502,532		probably benign	Het
Nacad	T	A	11: 6,598,370	K1426*	probably null	Het
Ndufb6	A	G	4: 40,279,234	L35S	probably damaging	Het
Nkapl	A	G	13: 21,467,609	I278T	probably benign	Het
Nrbp2	T	C	15: 76,089,483	E263G	probably damaging	Het
Nup85	T	A	11: 115,580,512	L110Q	probably damaging	Het
Olfr1251	A	T	2: 89,667,802	M28K	possibly damaging	Het
Olfr1415	T	A	1: 92,491,093	I221F	probably damaging	Het
Olfr1448	T	A	19: 12,920,015	Q98L	probably damaging	Het
Olfr293	A	G	7: 86,664,085	N141S	possibly damaging	Het
Olfr395	A	G	11: 73,906,895	I199T	probably damaging	Het
Olfr720	T	C	14: 14,175,314	Y256C	probably damaging	Het
Polr2m	C	T	9: 71,483,636	D95N	probably benign	Het
Popdc2	A	T	16: 38,374,303	D362V	probably damaging	Het
Pot1a	A	T	6: 25,758,856	I308N	possibly damaging	Het
Rsf1	GCGGCGGC	GCGGCGGCGTCGGCGGC	7: 97,579,928		probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rundc3a	G	A	11: 102,399,399	E189K	possibly damaging	Het
Scaf1	A	C	7: 45,012,806		probably null	Het
Scaper	T	C	9: 55,859,076		probably null	Het
Sh3glb1	C	T	3: 144,712,649	C51Y	probably damaging	Het
Slc10a5	T	C	3: 10,335,331	T90A	probably benign	Het
Slc41a2	C	A	10: 83,297,159	C341F	probably benign	Het
Spata31	A	G	13: 64,920,313	*67W	probably null	Het
Stap2	C	T	17: 56,000,475		probably null	Het
Stt3a	A	T	9: 36,752,400	M182K	probably benign	Het
Tcfl5	G	A	2: 180,642,257		silent	Het
Tmx3	T	C	18: 90,537,101	V314A	probably benign	Het
Upf1	A	G	8: 70,338,517	L525P	probably damaging	Het
Wdr6	T	C	9: 108,575,782	I301V	possibly damaging	Het
Ylpm1	T	A	12: 85,060,251		probably null	Het
Zfp273	T	C	13: 67,825,331	Y160H	probably damaging	Het

Other mutations in Slc17a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00920:Slc17a3	APN	13	23856481	missense	probably benign	0.20
IGL02569:Slc17a3	APN	13	23846302	missense	probably damaging	1.00
IGL02628:Slc17a3	APN	13	23842451	start codon destroyed	probably null	1.00
IGL02745:Slc17a3	APN	13	23842486	missense	probably benign	0.01
IGL03001:Slc17a3	APN	13	23856784	missense	probably damaging	1.00
IGL03143:Slc17a3	APN	13	23855979	splice site	probably null
IGL03144:Slc17a3	APN	13	23846440	missense	probably benign	0.00
R0052:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0054:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0152:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0153:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0233:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0234:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0257:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0294:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0295:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0318:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0319:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0352:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0462:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0610:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0627:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0652:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0765:Slc17a3	UTSW	13	23846896	nonsense	probably null
R1529:Slc17a3	UTSW	13	23845445	missense	probably damaging	1.00
R1532:Slc17a3	UTSW	13	23856500	missense	probably damaging	1.00
R1569:Slc17a3	UTSW	13	23855608	missense	probably benign	0.09
R1640:Slc17a3	UTSW	13	23852357	nonsense	probably null
R1643:Slc17a3	UTSW	13	23857198	splice site	probably benign
R1715:Slc17a3	UTSW	13	23856741	missense	probably benign	0.19
R2407:Slc17a3	UTSW	13	23852435	critical splice donor site	probably null
R2512:Slc17a3	UTSW	13	23846247	missense	probably benign	0.13
R3923:Slc17a3	UTSW	13	23858054	missense	possibly damaging	0.89
R4449:Slc17a3	UTSW	13	23856732	missense	probably damaging	0.99
R5166:Slc17a3	UTSW	13	23842542	critical splice donor site	probably null
R5989:Slc17a3	UTSW	13	23842428	start gained	probably benign
R6281:Slc17a3	UTSW	13	23856799	missense	probably benign	0.17
R6811:Slc17a3	UTSW	13	23855941	missense	possibly damaging	0.61
R7283:Slc17a3	UTSW	13	23855848	missense
R7341:Slc17a3	UTSW	13	23846884	nonsense	probably null
R7467:Slc17a3	UTSW	13	23846967	critical splice donor site	probably null
R7485:Slc17a3	UTSW	13	23855849	missense
R8065:Slc17a3	UTSW	13	23858087	missense	unknown
R8770:Slc17a3	UTSW	13	23855624	missense

Predicted Primers

PCR Primer
(F):5'- TGCAGGACATTGAACCCCATTAC -3'
(R):5'- AAGGGTGAGATGCATTCTTTGAC -3'

Sequencing Primer
(F):5'- TGAACCCCATTACCCAAAATATCTTG -3'
(R):5'- GACTGTTAAATGCTTACACCATGC -3'

Posted On

2016-11-21