Incidental Mutation 'R5748:Zfp273'
ID445889
Institutional Source Beutler Lab
Gene Symbol Zfp273
Ensembl Gene ENSMUSG00000030446
Gene Namezinc finger protein 273
Synonyms6820416H06Rik
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67813740-67827002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67825331 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 160 (Y160H)
Ref Sequence ENSEMBL: ENSMUSP00000012725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012725] [ENSMUST00000181391]
Predicted Effect probably damaging
Transcript: ENSMUST00000012725
AA Change: Y160H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000012725
Gene: ENSMUSG00000030446
AA Change: Y160H

DomainStartEndE-ValueType
KRAB 1 32 1.97e-1 SMART
ZnF_C2H2 48 70 1.95e-3 SMART
ZnF_C2H2 76 98 4.94e-5 SMART
ZnF_C2H2 104 126 6.32e-3 SMART
ZnF_C2H2 132 154 3.39e-3 SMART
ZnF_C2H2 160 182 2.99e-4 SMART
ZnF_C2H2 188 210 4.24e-4 SMART
ZnF_C2H2 216 238 1.45e-2 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.91e-2 SMART
ZnF_C2H2 300 322 6.78e-3 SMART
ZnF_C2H2 328 350 2.71e-2 SMART
ZnF_C2H2 356 378 4.17e-3 SMART
ZnF_C2H2 384 406 1.38e-3 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 1.2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181391
AA Change: Y193H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137903
Gene: ENSMUSG00000030446
AA Change: Y193H

DomainStartEndE-ValueType
KRAB 5 65 9.25e-28 SMART
ZnF_C2H2 81 103 1.95e-3 SMART
ZnF_C2H2 109 131 4.94e-5 SMART
ZnF_C2H2 137 159 6.32e-3 SMART
ZnF_C2H2 165 187 3.39e-3 SMART
ZnF_C2H2 193 215 2.99e-4 SMART
ZnF_C2H2 221 243 4.24e-4 SMART
ZnF_C2H2 249 271 1.45e-2 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 2.91e-2 SMART
ZnF_C2H2 333 355 6.78e-3 SMART
ZnF_C2H2 361 383 2.71e-2 SMART
ZnF_C2H2 389 411 4.17e-3 SMART
ZnF_C2H2 417 439 1.38e-3 SMART
ZnF_C2H2 445 467 1.98e-4 SMART
ZnF_C2H2 473 495 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181912
Meta Mutation Damage Score 0.5271 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Other mutations in Zfp273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03115:Zfp273 APN 13 67825650 missense probably damaging 1.00
R1969:Zfp273 UTSW 13 67825163 missense probably damaging 1.00
R2679:Zfp273 UTSW 13 67825776 missense probably benign 0.39
R3736:Zfp273 UTSW 13 67825507 nonsense probably null
R4832:Zfp273 UTSW 13 67825365 missense probably benign 0.01
R4896:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5004:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5223:Zfp273 UTSW 13 67826179 missense probably damaging 1.00
R5948:Zfp273 UTSW 13 67825799 missense probably benign 0.43
R6102:Zfp273 UTSW 13 67822347 missense probably damaging 1.00
R6668:Zfp273 UTSW 13 67825124 missense probably damaging 0.99
R7192:Zfp273 UTSW 13 67825064 missense possibly damaging 0.82
R7478:Zfp273 UTSW 13 67825132 missense probably benign 0.30
R7792:Zfp273 UTSW 13 67826016 missense possibly damaging 0.71
R7874:Zfp273 UTSW 13 67825439 missense probably benign 0.00
R8261:Zfp273 UTSW 13 67825951 missense probably benign 0.12
R8424:Zfp273 UTSW 13 67822352 missense probably benign 0.17
X0028:Zfp273 UTSW 13 67823142 missense probably benign 0.20
Z1088:Zfp273 UTSW 13 67825394 missense possibly damaging 0.91
Z1176:Zfp273 UTSW 13 67823146 missense probably null
Predicted Primers PCR Primer
(F):5'- ACTGGAGAGAAACCCTACAAATGT -3'
(R):5'- TTTCATGCCAGTATGGATTCGAC -3'

Sequencing Primer
(F):5'- CCCTACAAATGTGAAGTGTGTGGC -3'
(R):5'- CCAGTATGGATTCGACGATGC -3'
Posted On2016-11-21