Incidental Mutation 'R0029:Itga2'
ID44589
Institutional Source Beutler Lab
Gene Symbol Itga2
Ensembl Gene ENSMUSG00000015533
Gene Nameintegrin alpha 2
SynonymsVLA-2 receptor, alpha 2 subunit, DX5, CD49B
MMRRC Submission 038323-MU
Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0029 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114833081-114932100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 114870496 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 432 (S432L)
Ref Sequence ENSEMBL: ENSMUSP00000053891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056117]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056117
AA Change: S432L

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: S432L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Int_alpha 41 96 4.91e-4 SMART
VWA 169 359 2.42e-39 SMART
Blast:VWA 364 424 4e-26 BLAST
Int_alpha 430 481 2.59e-3 SMART
Int_alpha 484 541 3.5e-9 SMART
Int_alpha 547 602 3.11e-15 SMART
Int_alpha 611 669 2.52e-1 SMART
low complexity region 890 910 N/A INTRINSIC
transmembrane domain 1129 1151 N/A INTRINSIC
Pfam:Integrin_alpha 1152 1166 9e-7 PFAM
Meta Mutation Damage Score 0.6277 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 94% (48/51)
MGI Phenotype Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik T C 15: 98,585,309 probably null Het
Abca15 T C 7: 120,346,002 F434L probably benign Het
Abt1 A T 13: 23,422,508 F141Y possibly damaging Het
Anapc15-ps A G 10: 95,672,995 I141T probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Axin2 A G 11: 108,924,047 T254A probably benign Het
Ciz1 A G 2: 32,371,419 probably benign Het
Cpa4 A G 6: 30,585,045 Y276C probably damaging Het
Cpt1a A G 19: 3,381,674 D698G probably benign Het
Crebbp T C 16: 4,117,443 T861A probably damaging Het
Dpy19l2 T A 9: 24,558,101 D753V probably damaging Het
Exosc7 A T 9: 123,119,237 probably benign Het
Fbxw28 T A 9: 109,328,289 D244V probably damaging Het
Fgd5 A G 6: 92,067,558 D1260G probably benign Het
Gapvd1 T A 2: 34,678,141 I1404F probably damaging Het
Gas7 A G 11: 67,643,337 S88G probably benign Het
Hk1 T C 10: 62,315,394 D57G probably damaging Het
Il23r A C 6: 67,478,945 probably null Het
Impg1 T C 9: 80,398,371 D138G probably damaging Het
Kirrel2 A G 7: 30,453,165 probably benign Het
Lipm T C 19: 34,116,548 probably benign Het
Lrpap1 T C 5: 35,097,677 N205S possibly damaging Het
Mboat4 T G 8: 34,120,209 F87V probably damaging Het
Nadsyn1 G C 7: 143,806,078 Q386E probably benign Het
Nell1 G A 7: 50,120,715 probably benign Het
Olfr209 T C 16: 59,361,541 R226G probably benign Het
Olfr955 T A 9: 39,470,660 E22V probably benign Het
Pard3 G T 8: 127,426,758 probably benign Het
Per2 C A 1: 91,423,712 R1024L possibly damaging Het
Phf11c T C 14: 59,384,915 D216G probably benign Het
Polk G A 13: 96,516,670 T74I probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Psmb7 T A 2: 38,633,907 H152L probably damaging Het
Ralgps1 A T 2: 33,141,019 D498E probably benign Het
Slc26a2 G A 18: 61,202,310 P24S possibly damaging Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Stk38 T C 17: 28,982,138 E188G probably benign Het
Sulf2 T C 2: 166,116,973 N105S possibly damaging Het
Sult2a3 T A 7: 14,073,074 M228L probably benign Het
Svil C A 18: 5,063,286 D852E probably benign Het
Tcaf2 A T 6: 42,630,159 L287* probably null Het
Tmem132e A T 11: 82,444,761 I890F probably damaging Het
Tmem63a A G 1: 180,962,466 Y401C probably benign Het
Ttn T C 2: 76,766,506 E20021G probably damaging Het
Ubac1 G T 2: 26,021,443 T31N probably benign Het
Usp29 T C 7: 6,961,581 L141P probably damaging Het
Vmn1r179 A T 7: 23,929,205 I274F probably benign Het
Vmn1r204 A G 13: 22,556,418 Y73C probably benign Het
Vmn2r2 T C 3: 64,116,944 I739V probably benign Het
Wisp1 C T 15: 66,912,864 R129C probably damaging Het
Other mutations in Itga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Itga2 APN 13 114877625 missense probably damaging 0.99
IGL01481:Itga2 APN 13 114859632 missense possibly damaging 0.63
IGL01666:Itga2 APN 13 114837091 critical splice donor site probably null
IGL01730:Itga2 APN 13 114854411 splice site probably benign
IGL01965:Itga2 APN 13 114848064 splice site probably benign
IGL01987:Itga2 APN 13 114847946 nonsense probably null
IGL02334:Itga2 APN 13 114865309 critical splice donor site probably null
IGL02381:Itga2 APN 13 114856722 missense probably damaging 1.00
IGL02562:Itga2 APN 13 114836570 unclassified probably benign
IGL03191:Itga2 APN 13 114836484 unclassified probably benign
IGL03209:Itga2 APN 13 114880632 missense probably damaging 1.00
P0007:Itga2 UTSW 13 114866199 missense probably damaging 1.00
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0025:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0149:Itga2 UTSW 13 114836579 unclassified probably benign
R0152:Itga2 UTSW 13 114866314 missense probably benign 0.06
R0496:Itga2 UTSW 13 114853899 missense probably benign 0.00
R0502:Itga2 UTSW 13 114845856 missense probably benign 0.15
R0599:Itga2 UTSW 13 114856650 splice site probably benign
R0688:Itga2 UTSW 13 114839554 missense probably benign 0.00
R0704:Itga2 UTSW 13 114862375 missense possibly damaging 0.91
R0760:Itga2 UTSW 13 114859632 missense possibly damaging 0.63
R0811:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0812:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0836:Itga2 UTSW 13 114856679 missense probably damaging 0.99
R1196:Itga2 UTSW 13 114866155 critical splice donor site probably null
R1546:Itga2 UTSW 13 114849420 missense possibly damaging 0.63
R1639:Itga2 UTSW 13 114857296 missense probably benign 0.00
R1834:Itga2 UTSW 13 114856726 missense probably damaging 0.98
R1834:Itga2 UTSW 13 114856727 missense probably damaging 1.00
R2180:Itga2 UTSW 13 114849381 missense possibly damaging 0.67
R2190:Itga2 UTSW 13 114870605 missense probably benign 0.05
R2518:Itga2 UTSW 13 114881042 missense probably damaging 1.00
R3885:Itga2 UTSW 13 114869299 missense probably benign 0.35
R3962:Itga2 UTSW 13 114839518 missense probably damaging 0.99
R4094:Itga2 UTSW 13 114870625 missense probably benign 0.01
R4193:Itga2 UTSW 13 114886649 nonsense probably null
R4290:Itga2 UTSW 13 114866173 missense probably damaging 0.98
R4459:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4460:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4628:Itga2 UTSW 13 114877693 missense probably benign 0.03
R4655:Itga2 UTSW 13 114873269 missense probably benign 0.00
R4716:Itga2 UTSW 13 114857373 missense probably damaging 0.98
R4896:Itga2 UTSW 13 114853766 nonsense probably null
R5093:Itga2 UTSW 13 114856181 missense probably benign 0.00
R5488:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5489:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5743:Itga2 UTSW 13 114884506 missense probably damaging 1.00
R5767:Itga2 UTSW 13 114839570 missense possibly damaging 0.88
R5790:Itga2 UTSW 13 114868206 missense probably benign 0.02
R5923:Itga2 UTSW 13 114884519 missense probably benign 0.02
R6163:Itga2 UTSW 13 114866190 missense probably damaging 1.00
R6227:Itga2 UTSW 13 114839561 missense probably benign 0.30
R6278:Itga2 UTSW 13 114845888 missense probably benign 0.05
R6283:Itga2 UTSW 13 114869250 missense probably damaging 1.00
R6332:Itga2 UTSW 13 114843473 missense probably benign
R6510:Itga2 UTSW 13 114873280 missense probably damaging 1.00
R6742:Itga2 UTSW 13 114836525 missense possibly damaging 0.93
R6869:Itga2 UTSW 13 114875537 synonymous probably null
R7073:Itga2 UTSW 13 114859613 missense probably damaging 1.00
R7111:Itga2 UTSW 13 114900530 missense unknown
R7236:Itga2 UTSW 13 114877691 missense probably benign
R7269:Itga2 UTSW 13 114886689 nonsense probably null
R7296:Itga2 UTSW 13 114857394 splice site probably null
R7350:Itga2 UTSW 13 114837202 missense probably damaging 0.98
R7375:Itga2 UTSW 13 114869217 missense probably benign 0.06
R7501:Itga2 UTSW 13 114875559 missense probably damaging 1.00
R7687:Itga2 UTSW 13 114866260 missense probably damaging 1.00
Z1088:Itga2 UTSW 13 114857332 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTCAGGTAGTGAACATCACTGGATGC -3'
(R):5'- TGGATGCCACAGCTCATGGTAAGC -3'

Sequencing Primer
(F):5'- TTTTGGAGACCCAACTGGC -3'
(R):5'- GGTGTTTGACTCACCTGAATTCC -3'
Posted On2013-06-11