Incidental Mutation 'R5748:Gtse1'
ID445895
Institutional Source Beutler Lab
Gene Symbol Gtse1
Ensembl Gene ENSMUSG00000022385
Gene NameG two S phase expressed protein 1
SynonymsB99, Gtse-1
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85859745-85876573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85867577 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 324 (Y324H)
Ref Sequence ENSEMBL: ENSMUSP00000155552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170629] [ENSMUST00000231074]
Predicted Effect probably benign
Transcript: ENSMUST00000170629
AA Change: Y324H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: Y324H

DomainStartEndE-ValueType
Pfam:GTSE1_N 10 153 3e-62 PFAM
low complexity region 284 301 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
low complexity region 478 497 N/A INTRINSIC
low complexity region 568 593 N/A INTRINSIC
low complexity region 644 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231074
AA Change: Y324H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dhx16 T C 17: 35,883,314 L439P probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Gtse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gtse1 APN 15 85868817 missense possibly damaging 0.54
IGL01344:Gtse1 APN 15 85862066 critical splice acceptor site probably null
IGL01541:Gtse1 APN 15 85875654 nonsense probably null
IGL01621:Gtse1 APN 15 85875082 missense probably benign 0.01
IGL01945:Gtse1 APN 15 85871547 missense probably benign 0.00
IGL02193:Gtse1 APN 15 85862330 missense probably benign 0.27
IGL02215:Gtse1 APN 15 85862598 missense possibly damaging 0.92
IGL02494:Gtse1 APN 15 85867503 missense probably damaging 1.00
IGL02879:Gtse1 APN 15 85869063 splice site probably benign
R0009:Gtse1 UTSW 15 85862435 missense probably benign 0.06
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0576:Gtse1 UTSW 15 85869051 missense probably damaging 1.00
R1078:Gtse1 UTSW 15 85862307 missense probably damaging 0.98
R1442:Gtse1 UTSW 15 85860102 splice site probably benign
R1623:Gtse1 UTSW 15 85867578 missense probably benign
R1925:Gtse1 UTSW 15 85873738 missense probably benign 0.00
R1928:Gtse1 UTSW 15 85862063 splice site probably benign
R4565:Gtse1 UTSW 15 85875184 missense probably damaging 0.99
R5170:Gtse1 UTSW 15 85864264 critical splice donor site probably null
R5310:Gtse1 UTSW 15 85873792 missense probably benign 0.04
R5428:Gtse1 UTSW 15 85862139 missense probably benign 0.12
R5996:Gtse1 UTSW 15 85864180 missense probably benign 0.00
R6179:Gtse1 UTSW 15 85868957 missense possibly damaging 0.95
R6379:Gtse1 UTSW 15 85864224 missense probably benign 0.01
R6381:Gtse1 UTSW 15 85862148 missense probably benign 0.00
R6434:Gtse1 UTSW 15 85875169 missense probably benign 0.21
R7086:Gtse1 UTSW 15 85875549 missense probably damaging 1.00
R7304:Gtse1 UTSW 15 85871547 missense probably benign 0.00
R7485:Gtse1 UTSW 15 85868700 missense probably benign 0.04
R7580:Gtse1 UTSW 15 85862231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACTTTAGCAGAAGTAAGTATGTG -3'
(R):5'- TGAACAACCACATTTTCATGTCAGTTC -3'

Sequencing Primer
(F):5'- GTGTGTAGTTAACAAAATCCTGGC -3'
(R):5'- GTATGCCTCCAGCTGAGATCAC -3'
Posted On2016-11-21