Incidental Mutation 'R5748:Dhx16'
ID445898
Institutional Source Beutler Lab
Gene Symbol Dhx16
Ensembl Gene ENSMUSG00000024422
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 16
SynonymsDdx16, DBP2, 2410006N22Rik
MMRRC Submission 043355-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5748 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35879819-35892670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35883314 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 439 (L439P)
Ref Sequence ENSEMBL: ENSMUSP00000133888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025292] [ENSMUST00000174366]
Predicted Effect probably damaging
Transcript: ENSMUST00000025292
AA Change: L439P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025292
Gene: ENSMUSG00000024422
AA Change: L439P

DomainStartEndE-ValueType
Blast:DEXDc 55 310 6e-57 BLAST
DEXDc 400 585 7.26e-33 SMART
HELICc 636 733 1.7e-15 SMART
HA2 794 885 2.24e-31 SMART
Pfam:OB_NTP_bind 901 1018 3.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174330
Predicted Effect probably damaging
Transcript: ENSMUST00000174366
AA Change: L439P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133888
Gene: ENSMUSG00000024422
AA Change: L439P

DomainStartEndE-ValueType
Blast:DEXDc 55 310 9e-58 BLAST
DEXDc 400 585 7.26e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174449
Meta Mutation Damage Score 0.8967 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,089,699 Q285R probably damaging Het
Acy1 T A 9: 106,436,727 N78I probably damaging Het
Anln T C 9: 22,337,934 K166E probably damaging Het
C1qtnf4 A G 2: 90,889,533 D50G probably damaging Het
Cntnap2 A G 6: 45,715,884 T100A probably damaging Het
Cxcr6 C T 9: 123,810,341 R143C probably damaging Het
Dlk1 T C 12: 109,459,972 V257A probably benign Het
Ebpl A T 14: 61,360,344 L16Q probably null Het
Eml5 T A 12: 98,825,555 Y1234F probably damaging Het
Fam129b A T 2: 32,919,569 K260M probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gria1 A G 11: 57,309,876 D793G probably benign Het
Gtse1 T C 15: 85,867,577 Y324H probably benign Het
Hcn1 A T 13: 117,976,055 S852C probably damaging Het
Invs A G 4: 48,307,823 T83A probably damaging Het
Iqgap3 T C 3: 88,109,370 L155P probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc14b T A 13: 74,363,640 D107V probably damaging Het
Mcm9 A T 10: 53,625,729 H253Q probably damaging Het
Mcmdc2 A G 1: 9,911,807 Y30C probably damaging Het
Mdga1 C T 17: 29,850,551 D174N probably benign Het
Med13l G A 5: 118,593,445 R62H probably damaging Het
Mrgpra2b A G 7: 47,502,532 probably benign Het
Nacad T A 11: 6,598,370 K1426* probably null Het
Ndufb6 A G 4: 40,279,234 L35S probably damaging Het
Nkapl A G 13: 21,467,609 I278T probably benign Het
Nrbp2 T C 15: 76,089,483 E263G probably damaging Het
Nup85 T A 11: 115,580,512 L110Q probably damaging Het
Olfr1251 A T 2: 89,667,802 M28K possibly damaging Het
Olfr1415 T A 1: 92,491,093 I221F probably damaging Het
Olfr1448 T A 19: 12,920,015 Q98L probably damaging Het
Olfr293 A G 7: 86,664,085 N141S possibly damaging Het
Olfr395 A G 11: 73,906,895 I199T probably damaging Het
Olfr720 T C 14: 14,175,314 Y256C probably damaging Het
Polr2m C T 9: 71,483,636 D95N probably benign Het
Popdc2 A T 16: 38,374,303 D362V probably damaging Het
Pot1a A T 6: 25,758,856 I308N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rundc3a G A 11: 102,399,399 E189K possibly damaging Het
Scaf1 A C 7: 45,012,806 probably null Het
Scaper T C 9: 55,859,076 probably null Het
Sh3glb1 C T 3: 144,712,649 C51Y probably damaging Het
Slc10a5 T C 3: 10,335,331 T90A probably benign Het
Slc17a3 T A 13: 23,856,466 S336T probably damaging Het
Slc41a2 C A 10: 83,297,159 C341F probably benign Het
Spata31 A G 13: 64,920,313 *67W probably null Het
Stap2 C T 17: 56,000,475 probably null Het
Stt3a A T 9: 36,752,400 M182K probably benign Het
Tcfl5 G A 2: 180,642,257 silent Het
Tmx3 T C 18: 90,537,101 V314A probably benign Het
Upf1 A G 8: 70,338,517 L525P probably damaging Het
Wdr6 T C 9: 108,575,782 I301V possibly damaging Het
Ylpm1 T A 12: 85,060,251 probably null Het
Zfp273 T C 13: 67,825,331 Y160H probably damaging Het
Other mutations in Dhx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dhx16 APN 17 35887934 missense probably benign 0.02
IGL01533:Dhx16 APN 17 35882047 missense probably damaging 1.00
IGL01743:Dhx16 APN 17 35888108 missense probably damaging 1.00
IGL01946:Dhx16 APN 17 35885504 missense probably benign 0.01
IGL02170:Dhx16 APN 17 35889469 missense probably damaging 1.00
IGL02327:Dhx16 APN 17 35883825 missense probably benign 0.00
IGL02334:Dhx16 APN 17 35884057 missense probably damaging 1.00
IGL02417:Dhx16 APN 17 35892537 missense probably damaging 1.00
R0403:Dhx16 UTSW 17 35883050 critical splice donor site probably null
R0410:Dhx16 UTSW 17 35890967 missense probably damaging 1.00
R0544:Dhx16 UTSW 17 35881659 missense probably benign 0.35
R0835:Dhx16 UTSW 17 35881689 missense probably damaging 1.00
R0845:Dhx16 UTSW 17 35883302 missense probably damaging 1.00
R1642:Dhx16 UTSW 17 35891065 missense probably damaging 1.00
R1833:Dhx16 UTSW 17 35885619 missense probably benign 0.36
R1905:Dhx16 UTSW 17 35888355 missense probably benign
R2233:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R2234:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R4647:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4648:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4665:Dhx16 UTSW 17 35879943 missense probably damaging 1.00
R4674:Dhx16 UTSW 17 35885939 missense probably damaging 1.00
R4862:Dhx16 UTSW 17 35883262 missense probably benign 0.34
R5089:Dhx16 UTSW 17 35884089 missense probably damaging 1.00
R5122:Dhx16 UTSW 17 35883310 missense probably damaging 1.00
R5665:Dhx16 UTSW 17 35891086 nonsense probably null
R5763:Dhx16 UTSW 17 35881688 missense possibly damaging 0.87
R5956:Dhx16 UTSW 17 35882870 missense probably damaging 0.96
R6001:Dhx16 UTSW 17 35883874 missense probably damaging 1.00
R6216:Dhx16 UTSW 17 35882972 missense possibly damaging 0.49
R6420:Dhx16 UTSW 17 35883014 missense possibly damaging 0.92
R6467:Dhx16 UTSW 17 35886184 missense probably damaging 1.00
R7326:Dhx16 UTSW 17 35886160 missense probably damaging 1.00
R7338:Dhx16 UTSW 17 35888144 missense probably damaging 1.00
R7457:Dhx16 UTSW 17 35891060 missense probably damaging 1.00
R7736:Dhx16 UTSW 17 35881676 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGACTCGAGGGCCTCTAAAG -3'
(R):5'- TCATGCAGGATGAAAGCCC -3'

Sequencing Primer
(F):5'- CCTCTAAAGGTGGTGGGGAC -3'
(R):5'- CAAATCTATAATATCCATCTCCCTGC -3'
Posted On2016-11-21