Incidental Mutation 'R5749:Rapgef4'
ID 445904
Institutional Source Beutler Lab
Gene Symbol Rapgef4
Ensembl Gene ENSMUSG00000049044
Gene Name Rap guanine nucleotide exchange factor (GEF) 4
Synonyms cAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 71981240-72257474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 72242757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 796 (T796S)
Ref Sequence ENSEMBL: ENSMUSP00000028525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028525] [ENSMUST00000090826] [ENSMUST00000102698]
AlphaFold Q9EQZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000028525
AA Change: T796S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028525
Gene: ENSMUSG00000049044
AA Change: T796S

DomainStartEndE-ValueType
DEP 72 147 3.43e-27 SMART
low complexity region 158 167 N/A INTRINSIC
cNMP 212 331 4.02e-15 SMART
RasGEFN 351 486 3.61e-7 SMART
Blast:RasGEF 534 607 1e-33 BLAST
RasGEF 624 866 8.09e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090826
AA Change: T940S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: T940S

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 216 291 3.43e-27 SMART
low complexity region 302 311 N/A INTRINSIC
cNMP 356 475 4.02e-15 SMART
RasGEFN 495 630 3.61e-7 SMART
Blast:RasGEF 678 751 2e-33 BLAST
RasGEF 768 1010 8.09e-105 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102698
AA Change: T922S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: T922S

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
cNMP 43 162 4.62e-15 SMART
DEP 198 273 3.43e-27 SMART
low complexity region 284 293 N/A INTRINSIC
cNMP 338 457 4.02e-15 SMART
RasGEFN 477 612 3.61e-7 SMART
Blast:RasGEF 660 733 2e-33 BLAST
RasGEF 750 992 8.09e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153887
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Rapgef4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Rapgef4 APN 2 72256312 missense possibly damaging 0.75
IGL00858:Rapgef4 APN 2 72198897 missense probably damaging 1.00
IGL01408:Rapgef4 APN 2 72174841 nonsense probably null
IGL01673:Rapgef4 APN 2 72241437 missense probably damaging 0.99
IGL01678:Rapgef4 APN 2 72242225 splice site probably benign
IGL01725:Rapgef4 APN 2 72174874 missense probably benign 0.24
IGL01871:Rapgef4 APN 2 72198360 missense possibly damaging 0.69
IGL01935:Rapgef4 APN 2 72234123 missense probably benign 0.05
IGL02001:Rapgef4 APN 2 72225052 splice site probably benign
IGL02041:Rapgef4 APN 2 72198796 missense probably damaging 1.00
IGL02134:Rapgef4 APN 2 72180061 missense probably damaging 0.97
IGL02410:Rapgef4 APN 2 72226594 missense possibly damaging 0.51
IGL02807:Rapgef4 APN 2 72205649 splice site probably benign
IGL03066:Rapgef4 APN 2 72141179 splice site probably benign
IGL03282:Rapgef4 APN 2 72205752 splice site probably benign
IGL03291:Rapgef4 APN 2 72195703 missense probably damaging 1.00
P0033:Rapgef4 UTSW 2 72137331 intron probably benign
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0045:Rapgef4 UTSW 2 72198778 missense possibly damaging 0.80
R0309:Rapgef4 UTSW 2 72226030 missense probably benign 0.02
R0398:Rapgef4 UTSW 2 72031041 missense probably damaging 0.99
R0747:Rapgef4 UTSW 2 72223073 missense possibly damaging 0.66
R1216:Rapgef4 UTSW 2 72208148 missense possibly damaging 0.51
R1264:Rapgef4 UTSW 2 72031105 missense possibly damaging 0.48
R1302:Rapgef4 UTSW 2 72045160 missense probably benign 0.31
R1460:Rapgef4 UTSW 2 72031176 critical splice donor site probably null
R1483:Rapgef4 UTSW 2 72055026 critical splice donor site probably null
R1682:Rapgef4 UTSW 2 72226568 missense possibly damaging 0.80
R1768:Rapgef4 UTSW 2 72225787 splice site probably benign
R1858:Rapgef4 UTSW 2 72031064 missense possibly damaging 0.67
R1860:Rapgef4 UTSW 2 72234720 missense probably benign 0.05
R1952:Rapgef4 UTSW 2 72208127 missense probably benign 0.07
R2025:Rapgef4 UTSW 2 72242739 missense probably benign 0.01
R2128:Rapgef4 UTSW 2 72226553 missense possibly damaging 0.87
R2159:Rapgef4 UTSW 2 72174881 missense probably damaging 1.00
R2201:Rapgef4 UTSW 2 72045189 missense probably damaging 0.96
R2883:Rapgef4 UTSW 2 72031125 missense probably benign
R3015:Rapgef4 UTSW 2 72198373 missense probably damaging 1.00
R4278:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R5256:Rapgef4 UTSW 2 72034034 missense probably damaging 0.97
R5572:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5574:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R5575:Rapgef4 UTSW 2 72034120 critical splice donor site probably null
R6007:Rapgef4 UTSW 2 72179949 missense possibly damaging 0.55
R6084:Rapgef4 UTSW 2 72196278 critical splice donor site probably null
R6192:Rapgef4 UTSW 2 71981317 missense probably benign 0.00
R6409:Rapgef4 UTSW 2 72178237 missense probably benign 0.01
R6683:Rapgef4 UTSW 2 72054779 intron probably benign
R6774:Rapgef4 UTSW 2 72225775 missense probably benign 0.01
R6844:Rapgef4 UTSW 2 72234626 missense probably damaging 0.99
R6999:Rapgef4 UTSW 2 72239125 missense probably damaging 1.00
R7077:Rapgef4 UTSW 2 72241476 missense probably damaging 0.96
R7138:Rapgef4 UTSW 2 72198363 missense probably damaging 1.00
R7275:Rapgef4 UTSW 2 72208101 missense probably damaging 1.00
R7352:Rapgef4 UTSW 2 72180091 missense probably damaging 1.00
R7397:Rapgef4 UTSW 2 72205666 missense probably benign 0.23
R7508:Rapgef4 UTSW 2 72205733 missense probably benign 0.00
R7620:Rapgef4 UTSW 2 72229078 missense probably damaging 0.99
R7703:Rapgef4 UTSW 2 72179971 missense probably benign 0.28
R7770:Rapgef4 UTSW 2 72198395 missense possibly damaging 0.95
R7814:Rapgef4 UTSW 2 72223117 missense probably benign
R7868:Rapgef4 UTSW 2 72201137 missense probably benign 0.11
R8210:Rapgef4 UTSW 2 72226020 missense probably benign 0.00
R8967:Rapgef4 UTSW 2 72226510 missense possibly damaging 0.72
R9113:Rapgef4 UTSW 2 72031149 missense probably benign 0.43
R9157:Rapgef4 UTSW 2 72174868 missense probably benign 0.06
R9314:Rapgef4 UTSW 2 72234639 missense possibly damaging 0.52
X0062:Rapgef4 UTSW 2 72226607 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCTCAGGTAAAGTGATTTGGAAAG -3'
(R):5'- AGACGGAGCCAATTTGAACC -3'

Sequencing Primer
(F):5'- GTGATTTGGAAAGTTAAACACCTAAC -3'
(R):5'- CGGAGCCAATTTGAACCAAATGTTTC -3'
Posted On 2016-11-21