Mutagenetix > Incidental Mutations

Incidental Mutation 'R5749:Rapgef4'

445904

Institutional Source

Beutler Lab

Gene Symbol

Rapgef4

Ensembl Gene

ENSMUSG00000049044

Gene Name

Rap guanine nucleotide exchange factor (GEF) 4

Synonyms

cAMP-GEFII, Epac2, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik

MMRRC Submission

043200-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.573) question?

Stock #

R5749 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71981240-72257474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72242757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 796 (T796S)

Ref Sequence

ENSEMBL: ENSMUSP00000028525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028525] [ENSMUST00000090826] [ENSMUST00000102698]

AlphaFold

Q9EQZ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000028525
AA Change: T796S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000028525
Gene: ENSMUSG00000049044
AA Change: T796S

Domain	Start	End	E-Value	Type
DEP	72	147	3.43e-27	SMART
low complexity region	158	167	N/A	INTRINSIC
cNMP	212	331	4.02e-15	SMART
RasGEFN	351	486	3.61e-7	SMART
Blast:RasGEF	534	607	1e-33	BLAST
RasGEF	624	866	8.09e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000090826
AA Change: T940S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000088336
Gene: ENSMUSG00000049044
AA Change: T940S

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	216	291	3.43e-27	SMART
low complexity region	302	311	N/A	INTRINSIC
cNMP	356	475	4.02e-15	SMART
RasGEFN	495	630	3.61e-7	SMART
Blast:RasGEF	678	751	2e-33	BLAST
RasGEF	768	1010	8.09e-105	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102698
AA Change: T922S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099759
Gene: ENSMUSG00000049044
AA Change: T922S

Domain	Start	End	E-Value	Type
low complexity region	3	13	N/A	INTRINSIC
cNMP	43	162	4.62e-15	SMART
DEP	198	273	3.43e-27	SMART
low complexity region	284	293	N/A	INTRINSIC
cNMP	338	457	4.02e-15	SMART
RasGEFN	477	612	3.61e-7	SMART
Blast:RasGEF	660	733	2e-33	BLAST
RasGEF	750	992	8.09e-105	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132792

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146970

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153887

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin granule fusion in pancreatic islet cells during the first phase of cAMP-dependent insulin granule exocytosis. Mice homozygous for a knock-out allele exhibit impaired isoproterenol-induced SR calcium leak and arrhythmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsl6	G	A	11: 54,324,055		probably null	Het
Ankrd12	T	C	17: 65,986,096	S781G	probably benign	Het
Bicc1	A	G	10: 70,946,969	S523P	probably benign	Het
Ccdc163	T	A	4: 116,714,112	C44*	probably null	Het
Ccdc83	T	C	7: 90,223,948	T400A	probably damaging	Het
Cobl	A	G	11: 12,266,965	S426P	possibly damaging	Het
Cyhr1	A	C	15: 76,658,644		probably null	Het
Cyp2b19	T	C	7: 26,763,419	I242T	possibly damaging	Het
Efnb2	A	C	8: 8,639,347	C92G	probably damaging	Het
Fam90a1a	T	A	8: 21,963,041	S137R	possibly damaging	Het
Fbxo17	G	A	7: 28,737,472	R284H	probably damaging	Het
Fem1b	A	G	9: 62,797,006	L324P	probably damaging	Het
Fsd1	T	A	17: 55,995,849		probably null	Het
Gtpbp4	A	G	13: 8,995,947		probably null	Het
Ifi209	A	C	1: 173,637,327	I8L	probably damaging	Het
Itga8	T	C	2: 12,262,078	E182G	probably damaging	Het
Itsn1	T	A	16: 91,906,855	L87H	probably damaging	Het
Klk1b16	T	C	7: 44,140,786	I160T	probably benign	Het
Lbp	T	A	2: 158,319,753	V52D	probably damaging	Het
Med23	T	C	10: 24,888,449	V318A	possibly damaging	Het
Myo16	C	T	8: 10,413,245	S604L	probably benign	Het
Olfr1113	C	T	2: 87,212,943	T17I	probably benign	Het
Olfr1448	A	G	19: 12,920,225	V28A	probably benign	Het
Olfr1510	T	A	14: 52,410,504	M123L	probably damaging	Het
Olfr768	A	T	10: 129,093,097	N292K	probably damaging	Het
Pcdh8	T	C	14: 79,770,085	D346G	probably damaging	Het
Ppara	A	T	15: 85,789,028	D140V	probably benign	Het
Prlr	T	A	15: 10,328,718	D426E	probably benign	Het
Prss36	T	A	7: 127,933,642	I192F	probably damaging	Het
Psg25	T	C	7: 18,524,851	E300G	probably damaging	Het
Pxylp1	A	G	9: 96,856,371	F26L	possibly damaging	Het
Stard9	A	G	2: 120,703,786	H3508R	probably damaging	Het
Tep1	T	A	14: 50,844,072	D1282V	possibly damaging	Het
Tgfbr3l	A	G	8: 4,249,310	E59G	probably damaging	Het
Tnik	T	C	3: 28,594,092	M431T	probably benign	Het
Tns3	A	T	11: 8,451,177	H1040Q	probably benign	Het
Usp10	G	A	8: 119,941,133	E58K	probably damaging	Het
Vmn2r23	A	G	6: 123,733,273	T512A	probably benign	Het
Vmn2r52	C	T	7: 10,159,032	D727N	probably damaging	Het
Vmn2r66	T	A	7: 85,006,771	K346*	probably null	Het
Vmn2r93	T	A	17: 18,298,284	F2I	probably benign	Het
Zfp697	T	C	3: 98,425,464	S69P	probably benign	Het

Other mutations in Rapgef4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rapgef4	APN	2	72256312	missense	possibly damaging	0.75
IGL00858:Rapgef4	APN	2	72198897	missense	probably damaging	1.00
IGL01408:Rapgef4	APN	2	72174841	nonsense	probably null
IGL01673:Rapgef4	APN	2	72241437	missense	probably damaging	0.99
IGL01678:Rapgef4	APN	2	72242225	splice site	probably benign
IGL01725:Rapgef4	APN	2	72174874	missense	probably benign	0.24
IGL01871:Rapgef4	APN	2	72198360	missense	possibly damaging	0.69
IGL01935:Rapgef4	APN	2	72234123	missense	probably benign	0.05
IGL02001:Rapgef4	APN	2	72225052	splice site	probably benign
IGL02041:Rapgef4	APN	2	72198796	missense	probably damaging	1.00
IGL02134:Rapgef4	APN	2	72180061	missense	probably damaging	0.97
IGL02410:Rapgef4	APN	2	72226594	missense	possibly damaging	0.51
IGL02807:Rapgef4	APN	2	72205649	splice site	probably benign
IGL03066:Rapgef4	APN	2	72141179	splice site	probably benign
IGL03282:Rapgef4	APN	2	72205752	splice site	probably benign
IGL03291:Rapgef4	APN	2	72195703	missense	probably damaging	1.00
P0033:Rapgef4	UTSW	2	72137331	intron	probably benign
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0045:Rapgef4	UTSW	2	72198778	missense	possibly damaging	0.80
R0309:Rapgef4	UTSW	2	72226030	missense	probably benign	0.02
R0398:Rapgef4	UTSW	2	72031041	missense	probably damaging	0.99
R0747:Rapgef4	UTSW	2	72223073	missense	possibly damaging	0.66
R1216:Rapgef4	UTSW	2	72208148	missense	possibly damaging	0.51
R1264:Rapgef4	UTSW	2	72031105	missense	possibly damaging	0.48
R1302:Rapgef4	UTSW	2	72045160	missense	probably benign	0.31
R1460:Rapgef4	UTSW	2	72031176	critical splice donor site	probably null
R1483:Rapgef4	UTSW	2	72055026	critical splice donor site	probably null
R1682:Rapgef4	UTSW	2	72226568	missense	possibly damaging	0.80
R1768:Rapgef4	UTSW	2	72225787	splice site	probably benign
R1858:Rapgef4	UTSW	2	72031064	missense	possibly damaging	0.67
R1860:Rapgef4	UTSW	2	72234720	missense	probably benign	0.05
R1952:Rapgef4	UTSW	2	72208127	missense	probably benign	0.07
R2025:Rapgef4	UTSW	2	72242739	missense	probably benign	0.01
R2128:Rapgef4	UTSW	2	72226553	missense	possibly damaging	0.87
R2159:Rapgef4	UTSW	2	72174881	missense	probably damaging	1.00
R2201:Rapgef4	UTSW	2	72045189	missense	probably damaging	0.96
R2883:Rapgef4	UTSW	2	72031125	missense	probably benign
R3015:Rapgef4	UTSW	2	72198373	missense	probably damaging	1.00
R4278:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R5256:Rapgef4	UTSW	2	72034034	missense	probably damaging	0.97
R5572:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5574:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R5575:Rapgef4	UTSW	2	72034120	critical splice donor site	probably null
R6007:Rapgef4	UTSW	2	72179949	missense	possibly damaging	0.55
R6084:Rapgef4	UTSW	2	72196278	critical splice donor site	probably null
R6192:Rapgef4	UTSW	2	71981317	missense	probably benign	0.00
R6409:Rapgef4	UTSW	2	72178237	missense	probably benign	0.01
R6683:Rapgef4	UTSW	2	72054779	intron	probably benign
R6774:Rapgef4	UTSW	2	72225775	missense	probably benign	0.01
R6844:Rapgef4	UTSW	2	72234626	missense	probably damaging	0.99
R6999:Rapgef4	UTSW	2	72239125	missense	probably damaging	1.00
R7077:Rapgef4	UTSW	2	72241476	missense	probably damaging	0.96
R7138:Rapgef4	UTSW	2	72198363	missense	probably damaging	1.00
R7275:Rapgef4	UTSW	2	72208101	missense	probably damaging	1.00
R7352:Rapgef4	UTSW	2	72180091	missense	probably damaging	1.00
R7397:Rapgef4	UTSW	2	72205666	missense	probably benign	0.23
R7508:Rapgef4	UTSW	2	72205733	missense	probably benign	0.00
R7620:Rapgef4	UTSW	2	72229078	missense	probably damaging	0.99
R7703:Rapgef4	UTSW	2	72179971	missense	probably benign	0.28
R7770:Rapgef4	UTSW	2	72198395	missense	possibly damaging	0.95
R7814:Rapgef4	UTSW	2	72223117	missense	probably benign
R7868:Rapgef4	UTSW	2	72201137	missense	probably benign	0.11
R8210:Rapgef4	UTSW	2	72226020	missense	probably benign	0.00
R8967:Rapgef4	UTSW	2	72226510	missense	possibly damaging	0.72
R9113:Rapgef4	UTSW	2	72031149	missense	probably benign	0.43
R9157:Rapgef4	UTSW	2	72174868	missense	probably benign	0.06
R9314:Rapgef4	UTSW	2	72234639	missense	possibly damaging	0.52
X0062:Rapgef4	UTSW	2	72226607	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ACCTCAGGTAAAGTGATTTGGAAAG -3'
(R):5'- AGACGGAGCCAATTTGAACC -3'

Sequencing Primer
(F):5'- GTGATTTGGAAAGTTAAACACCTAAC -3'
(R):5'- CGGAGCCAATTTGAACCAAATGTTTC -3'

Posted On

2016-11-21