Incidental Mutation 'R5749:Lbp'
ID 445907
Institutional Source Beutler Lab
Gene Symbol Lbp
Ensembl Gene ENSMUSG00000016024
Gene Name lipopolysaccharide binding protein
Synonyms Bpifd2
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 158306493-158332852 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 158319753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 52 (V52D)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016168]
AlphaFold Q61805
Predicted Effect probably damaging
Transcript: ENSMUST00000016168
AA Change: V245D

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016168
Gene: ENSMUSG00000016024
AA Change: V245D

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
BPI1 33 256 1.6e-88 SMART
BPI2 271 474 4.59e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129811
AA Change: V52D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118297
Gene: ENSMUSG00000016024
AA Change: V52D

DomainStartEndE-ValueType
SCOP:d1ewfa1 2 48 1e-15 SMART
Pfam:LBP_BPI_CETP_C 49 139 2.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152541
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mice have a generally normal phenotype but have an increased sensitivity to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Lbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Lbp APN 2 158328412 missense probably damaging 1.00
IGL01885:Lbp APN 2 158324573 missense probably damaging 1.00
IGL02224:Lbp APN 2 158306749 missense probably damaging 1.00
R0144:Lbp UTSW 2 158319710 missense probably damaging 1.00
R0478:Lbp UTSW 2 158317528 splice site probably benign
R1479:Lbp UTSW 2 158319714 missense probably damaging 1.00
R1569:Lbp UTSW 2 158319687 missense probably damaging 1.00
R2061:Lbp UTSW 2 158324579 missense probably benign 0.28
R4058:Lbp UTSW 2 158324630 missense probably damaging 1.00
R4854:Lbp UTSW 2 158327518 missense possibly damaging 0.58
R5027:Lbp UTSW 2 158308726 missense possibly damaging 0.61
R5910:Lbp UTSW 2 158324557 missense probably benign 0.02
R6135:Lbp UTSW 2 158317549 missense probably benign 0.09
R6650:Lbp UTSW 2 158309667 missense probably benign 0.36
R9406:Lbp UTSW 2 158317557 missense probably benign 0.06
Z1176:Lbp UTSW 2 158325762 missense probably damaging 1.00
Z1177:Lbp UTSW 2 158320306 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTCTTTAGTGGGCAGTAAGC -3'
(R):5'- CATACTCTGGAGGCCACATC -3'

Sequencing Primer
(F):5'- AGTAAGCGCTCCCTCTTCG -3'
(R):5'- ATAGAACACTCTGTGTGACTCC -3'
Posted On 2016-11-21