Incidental Mutation 'R5749:Vmn2r52'
ID445913
Institutional Source Beutler Lab
Gene Symbol Vmn2r52
Ensembl Gene ENSMUSG00000091930
Gene Namevomeronasal 2, receptor 52
SynonymsEG384534
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5749 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location10158652-10176286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10159032 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 727 (D727N)
Ref Sequence ENSEMBL: ENSMUSP00000129352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164918]
Predicted Effect probably damaging
Transcript: ENSMUST00000164918
AA Change: D727N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129352
Gene: ENSMUSG00000091930
AA Change: D727N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 8.1e-29 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 596 833 1.1e-55 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Vmn2r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r52 APN 7 10169096 missense probably benign 0.30
IGL00328:Vmn2r52 APN 7 10171417 missense probably benign 0.12
IGL00980:Vmn2r52 APN 7 10171090 missense probably damaging 1.00
IGL01468:Vmn2r52 APN 7 10158941 missense probably damaging 1.00
IGL01660:Vmn2r52 APN 7 10159180 missense probably damaging 0.97
IGL02215:Vmn2r52 APN 7 10171102 missense probably damaging 0.97
IGL03030:Vmn2r52 APN 7 10158872 missense probably benign 0.12
IGL03212:Vmn2r52 APN 7 10159547 missense possibly damaging 0.47
FR4589:Vmn2r52 UTSW 7 10159020 missense probably damaging 0.97
PIT4283001:Vmn2r52 UTSW 7 10170829 missense possibly damaging 0.89
R0184:Vmn2r52 UTSW 7 10159338 missense probably damaging 1.00
R0190:Vmn2r52 UTSW 7 10171388 missense probably benign 0.00
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0257:Vmn2r52 UTSW 7 10171055 nonsense probably null
R0310:Vmn2r52 UTSW 7 10159466 missense probably damaging 1.00
R1831:Vmn2r52 UTSW 7 10159488 missense probably damaging 1.00
R1862:Vmn2r52 UTSW 7 10173406 missense possibly damaging 0.94
R2484:Vmn2r52 UTSW 7 10169131 missense probably damaging 0.96
R2510:Vmn2r52 UTSW 7 10170868 missense probably benign
R3625:Vmn2r52 UTSW 7 10159178 missense probably damaging 1.00
R3803:Vmn2r52 UTSW 7 10173512 missense probably damaging 1.00
R4013:Vmn2r52 UTSW 7 10170676 missense probably benign 0.00
R4283:Vmn2r52 UTSW 7 10170638 missense possibly damaging 0.60
R4324:Vmn2r52 UTSW 7 10171013 missense possibly damaging 0.94
R4578:Vmn2r52 UTSW 7 10170690 missense probably damaging 1.00
R4806:Vmn2r52 UTSW 7 10159242 missense probably damaging 1.00
R5083:Vmn2r52 UTSW 7 10159465 nonsense probably null
R5249:Vmn2r52 UTSW 7 10176270 missense probably benign
R5306:Vmn2r52 UTSW 7 10170745 missense possibly damaging 0.88
R5332:Vmn2r52 UTSW 7 10169125 missense probably benign 0.17
R5617:Vmn2r52 UTSW 7 10170934 missense probably damaging 0.99
R5643:Vmn2r52 UTSW 7 10171132 missense probably damaging 1.00
R5763:Vmn2r52 UTSW 7 10171304 missense probably benign 0.01
R6103:Vmn2r52 UTSW 7 10171400 missense probably benign 0.36
R6148:Vmn2r52 UTSW 7 10171163 missense probably benign 0.00
R6356:Vmn2r52 UTSW 7 10168999 missense probably benign 0.01
R6412:Vmn2r52 UTSW 7 10171009 missense probably benign
R6657:Vmn2r52 UTSW 7 10159163 missense probably damaging 0.99
R6997:Vmn2r52 UTSW 7 10169071 missense probably benign 0.06
R7395:Vmn2r52 UTSW 7 10170817 missense probably benign 0.00
R7621:Vmn2r52 UTSW 7 10173347 missense probably benign 0.00
R7691:Vmn2r52 UTSW 7 10159182 missense probably damaging 0.97
R7852:Vmn2r52 UTSW 7 10158968 missense probably damaging 1.00
R7908:Vmn2r52 UTSW 7 10162950 missense probably benign
R7909:Vmn2r52 UTSW 7 10162950 missense probably benign
R7912:Vmn2r52 UTSW 7 10162950 missense probably benign
R7913:Vmn2r52 UTSW 7 10162950 missense probably benign
R7935:Vmn2r52 UTSW 7 10158968 missense probably damaging 1.00
R7993:Vmn2r52 UTSW 7 10162950 missense probably benign
R7994:Vmn2r52 UTSW 7 10162950 missense probably benign
Z1176:Vmn2r52 UTSW 7 10171200 missense probably damaging 0.97
Z1177:Vmn2r52 UTSW 7 10169190 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCCTTTGTGCTATGGTAGAC -3'
(R):5'- TGGCCAAAACAGTCACTGTC -3'

Sequencing Primer
(F):5'- ACACTAGCATGCTGAAGGTC -3'
(R):5'- AAACAGTCACTGTCATTCTGGC -3'
Posted On2016-11-21