Incidental Mutation 'R5749:Psg25'
ID445914
Institutional Source Beutler Lab
Gene Symbol Psg25
Ensembl Gene ENSMUSG00000070798
Gene Namepregnancy-specific glycoprotein 25
Synonymscea13
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5749 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18519702-18532269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18524851 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 300 (E300G)
Ref Sequence ENSEMBL: ENSMUSP00000092389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094795]
Predicted Effect probably damaging
Transcript: ENSMUST00000094795
AA Change: E300G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092389
Gene: ENSMUSG00000070798
AA Change: E300G

DomainStartEndE-ValueType
IG 40 141 2.15e-3 SMART
IG 160 261 1.55e0 SMART
IG 280 381 3.59e-5 SMART
IGc2 397 461 1.02e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Psg25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Psg25 APN 7 18526181 splice site probably benign
IGL00508:Psg25 APN 7 18529731 missense probably benign
IGL01154:Psg25 APN 7 18524699 missense probably benign 0.01
IGL01388:Psg25 APN 7 18529665 missense possibly damaging 0.87
IGL02222:Psg25 APN 7 18529727 missense probably damaging 1.00
IGL02261:Psg25 APN 7 18521343 missense probably benign 0.09
IGL02309:Psg25 APN 7 18526424 missense probably damaging 0.98
IGL02803:Psg25 APN 7 18526287 missense possibly damaging 0.47
IGL03334:Psg25 APN 7 18529774 missense probably benign 0.01
R0711:Psg25 UTSW 7 18529560 nonsense probably null
R1458:Psg25 UTSW 7 18529587 missense probably damaging 1.00
R1598:Psg25 UTSW 7 18532003 nonsense probably null
R2064:Psg25 UTSW 7 18521253 missense probably damaging 0.96
R2066:Psg25 UTSW 7 18529562 missense probably damaging 1.00
R4485:Psg25 UTSW 7 18526278 missense probably damaging 1.00
R4499:Psg25 UTSW 7 18524891 missense possibly damaging 0.89
R4514:Psg25 UTSW 7 18529608 nonsense probably null
R4547:Psg25 UTSW 7 18524704 missense probably damaging 1.00
R4604:Psg25 UTSW 7 18529803 missense probably benign 0.05
R4886:Psg25 UTSW 7 18524913 missense probably benign 0.00
R5121:Psg25 UTSW 7 18526536 missense possibly damaging 0.68
R5208:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5267:Psg25 UTSW 7 18524786 missense possibly damaging 0.78
R5376:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5425:Psg25 UTSW 7 18524784 nonsense probably null
R6050:Psg25 UTSW 7 18526478 missense probably benign 0.37
R6862:Psg25 UTSW 7 18521398 missense probably benign 0.03
R6962:Psg25 UTSW 7 18529754 missense probably damaging 1.00
R7238:Psg25 UTSW 7 18532202 start gained probably benign
R7782:Psg25 UTSW 7 18521302 missense probably benign 0.15
R7812:Psg25 UTSW 7 18521168 missense possibly damaging 0.71
Z1088:Psg25 UTSW 7 18529591 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTTTCTCAGTGACATCCTGG -3'
(R):5'- GACACACCCTTACATGCCTG -3'

Sequencing Primer
(F):5'- TTCTCAGTGACATCCTGGAGCAG -3'
(R):5'- TGCTTAGAATGCAGGTCACC -3'
Posted On2016-11-21