Incidental Mutation 'R5749:Cyp2b19'
ID 445915
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 26757142-26772630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26763419 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 242 (I242T)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
AlphaFold O55071
Predicted Effect possibly damaging
Transcript: ENSMUST00000077855
AA Change: I242T

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: I242T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Klk1b16 T C 7: 44,140,786 I160T probably benign Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26759417 missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26759079 missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26759064 missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26762378 missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26762384 missense probably benign
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26766762 missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26762229 splice site probably benign
R1514:Cyp2b19 UTSW 7 26767160 missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26763340 splice site probably null
R2362:Cyp2b19 UTSW 7 26764377 missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26763382 missense probably damaging 1.00
R4592:Cyp2b19 UTSW 7 26771394 missense probably benign 0.04
R4705:Cyp2b19 UTSW 7 26757292 missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26764376 missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26766821 missense probably damaging 0.99
R6041:Cyp2b19 UTSW 7 26759427 missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26759094 missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26771392 missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26763358 missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26759111 missense probably benign
R6656:Cyp2b19 UTSW 7 26766855 missense probably benign
R7283:Cyp2b19 UTSW 7 26766914 missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26759064 missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26771344 missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26767140 missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26771250 missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26757220 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CAAAAGCATGCATGTGTATGGTA -3'
(R):5'- CTCTGTCCCCTCCCATCTTT -3'

Sequencing Primer
(F):5'- TGTATGGTATACACACACACACAC -3'
(R):5'- TTTCTCTGACAACATCCCCATC -3'
Posted On 2016-11-21