Incidental Mutation 'R5749:Klk1b16'
ID 445917
Institutional Source Beutler Lab
Gene Symbol Klk1b16
Ensembl Gene ENSMUSG00000038968
Gene Name kallikrein 1-related peptidase b16
Synonyms Klk16, mGk-16
MMRRC Submission 043200-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5749 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 44136767-44141610 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44140786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 160 (I160T)
Ref Sequence ENSEMBL: ENSMUSP00000005933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005933]
AlphaFold P04071
Predicted Effect probably benign
Transcript: ENSMUST00000005933
AA Change: I160T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005933
Gene: ENSMUSG00000038968
AA Change: I160T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 7.64e-80 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 G A 11: 54,324,055 probably null Het
Ankrd12 T C 17: 65,986,096 S781G probably benign Het
Bicc1 A G 10: 70,946,969 S523P probably benign Het
Ccdc163 T A 4: 116,714,112 C44* probably null Het
Ccdc83 T C 7: 90,223,948 T400A probably damaging Het
Cobl A G 11: 12,266,965 S426P possibly damaging Het
Cyhr1 A C 15: 76,658,644 probably null Het
Cyp2b19 T C 7: 26,763,419 I242T possibly damaging Het
Efnb2 A C 8: 8,639,347 C92G probably damaging Het
Fam90a1a T A 8: 21,963,041 S137R possibly damaging Het
Fbxo17 G A 7: 28,737,472 R284H probably damaging Het
Fem1b A G 9: 62,797,006 L324P probably damaging Het
Fsd1 T A 17: 55,995,849 probably null Het
Gtpbp4 A G 13: 8,995,947 probably null Het
Ifi209 A C 1: 173,637,327 I8L probably damaging Het
Itga8 T C 2: 12,262,078 E182G probably damaging Het
Itsn1 T A 16: 91,906,855 L87H probably damaging Het
Lbp T A 2: 158,319,753 V52D probably damaging Het
Med23 T C 10: 24,888,449 V318A possibly damaging Het
Myo16 C T 8: 10,413,245 S604L probably benign Het
Olfr1113 C T 2: 87,212,943 T17I probably benign Het
Olfr1448 A G 19: 12,920,225 V28A probably benign Het
Olfr1510 T A 14: 52,410,504 M123L probably damaging Het
Olfr768 A T 10: 129,093,097 N292K probably damaging Het
Pcdh8 T C 14: 79,770,085 D346G probably damaging Het
Ppara A T 15: 85,789,028 D140V probably benign Het
Prlr T A 15: 10,328,718 D426E probably benign Het
Prss36 T A 7: 127,933,642 I192F probably damaging Het
Psg25 T C 7: 18,524,851 E300G probably damaging Het
Pxylp1 A G 9: 96,856,371 F26L possibly damaging Het
Rapgef4 A T 2: 72,242,757 T796S probably damaging Het
Stard9 A G 2: 120,703,786 H3508R probably damaging Het
Tep1 T A 14: 50,844,072 D1282V possibly damaging Het
Tgfbr3l A G 8: 4,249,310 E59G probably damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Tns3 A T 11: 8,451,177 H1040Q probably benign Het
Usp10 G A 8: 119,941,133 E58K probably damaging Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r52 C T 7: 10,159,032 D727N probably damaging Het
Vmn2r66 T A 7: 85,006,771 K346* probably null Het
Vmn2r93 T A 17: 18,298,284 F2I probably benign Het
Zfp697 T C 3: 98,425,464 S69P probably benign Het
Other mutations in Klk1b16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Klk1b16 APN 7 44140678 missense probably damaging 0.98
IGL01529:Klk1b16 APN 7 44140739 missense probably benign 0.18
R1105:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1106:Klk1b16 UTSW 7 44139513 missense probably damaging 0.98
R1559:Klk1b16 UTSW 7 44141001 missense probably benign 0.00
R3883:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R3884:Klk1b16 UTSW 7 44139463 missense possibly damaging 0.86
R4152:Klk1b16 UTSW 7 44140549 missense probably benign 0.09
R4398:Klk1b16 UTSW 7 44141427 missense probably damaging 1.00
R5231:Klk1b16 UTSW 7 44137347 missense probably damaging 1.00
R5389:Klk1b16 UTSW 7 44140988 missense possibly damaging 0.83
R5470:Klk1b16 UTSW 7 44137331 missense probably damaging 0.99
R5532:Klk1b16 UTSW 7 44141526 missense probably benign 0.00
R5690:Klk1b16 UTSW 7 44140894 critical splice acceptor site probably null
R5717:Klk1b16 UTSW 7 44139489 missense probably benign 0.00
R6589:Klk1b16 UTSW 7 44141470 missense probably benign 0.03
R7084:Klk1b16 UTSW 7 44139486 missense probably benign 0.01
R7336:Klk1b16 UTSW 7 44141483 missense probably benign 0.05
R8281:Klk1b16 UTSW 7 44141547 missense probably benign
R8358:Klk1b16 UTSW 7 44140761 missense probably damaging 1.00
R9002:Klk1b16 UTSW 7 44140765 missense possibly damaging 0.88
R9010:Klk1b16 UTSW 7 44140753 missense probably benign 0.40
R9013:Klk1b16 UTSW 7 44140908 missense probably benign 0.03
X0026:Klk1b16 UTSW 7 44140944 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCTGCTCAAAACCGATTGG -3'
(R):5'- CTTTGGCACAGTTCTCATTGGG -3'

Sequencing Primer
(F):5'- CGATTGGTCAGCAAAAGCTTC -3'
(R):5'- CACAGTTCTCATTGGGCAGGAG -3'
Posted On 2016-11-21